We narrowed to 17,590 results for: cript
-
Plasmid#10730DepositorAvailable SinceOct. 7, 2005AvailabilityAcademic Institutions and Nonprofits only
-
ACE2(-202)-luc
Plasmid#31112PurposeLuciferase reporter construct for human ACE2 promoterDepositorInsertACE2 promoter (ACE2 Human)
UseLuciferaseExpressionMammalianMutationpromoter region -202 to +103Available SinceOct. 14, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
ELK3_pet28a
Plasmid#131651PurposeBacterial expression of ETS gene ELK3DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGV3340
Plasmid#170278PurposeExpression of mutant HIV-2 RT p51 reverse transcriptaseDepositorInsertHIV-2 RT p51 (mutant)
TagsHexahistidineExpressionBacterialPromoterT7-lacAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
498 pSG5L HA RB del663 (NAAIRS)
Plasmid#10728DepositorInsertRB del663 (RB1 Human)
TagsHAExpressionMammalianMutationresidues 664 to 669 were replaced by NAAIRS, a fl…Available SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPB-PGK-hKLF4
Plasmid#60435PurposeOver-expression of human KLF4DepositorInsertKLF4 (KLF4 Human)
ExpressionMammalianAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
TACR2-Tango
Plasmid#66515PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK/CMV)-GtwyA
Plasmid#208574PurposeLV REPORT containing minimal promoter (GtwyA inserted into MCS) driving monomeric nuclear Tomato followed by an PKG/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmnucTomato
HSVtk
Neomycin
d2nucEGFP
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterPGK/CMV and minPAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-N748D
Plasmid#60732PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations N748D.DepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-K2-2xCSTREP
Plasmid#136149PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) K2DepositorInsertK2
ExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/V5-His-TN-DROSHA
Plasmid#106252PurposeExpress TN-DROSHA in mammalian cellsDepositorInsertDrosha Ribonuclease III (DROSHA Human)
TagsV5-HisExpressionMammalianMutationE1045Q and E1222Q mutationsPromoterCMVAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC620
Plasmid#62282PurposeExpresses dCas9, MCP-VP64, and PCP-VP64 in Yeast cellsDepositorInsertsMCP-VP64
PCP-VP64
dCas9
TagsVP64ExpressionYeastMutationNuclease activity has been inactivated by mutatio…PromoterpAdh and pTdh3Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
JDW 947 (pME-mmTcf4_DN_P2A_mCherry)
Plasmid#232122PurposeA middle entry gateway clone containing myc-tagged murine dominant negative Tcf4 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_DAZL-T2A-mGreenLantern-PuroTK
Plasmid#222917PurposeHomology directed repair template for knocking in mGreenLantern reporter to DAZL.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-S127A
Plasmid#17794DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationSerine 127 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB-DYRK1B
Plasmid#101771PurposeMammalian expression of DYRK1B fusion proteinDepositorInsertDYRK1B / MIRK (DYRK1B Human)
TagsS peptide-flag-streptavidin binding peptide (SFB)ExpressionMammalianMutationsiRNA-resistant alleleAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only