-
Plasmid#55486PurposeLocalization: GalT Targeting Sequence, Excitation: 462, Emission: 492DepositorInsertGolgi (B4GALT1 Human)
UseTagsmTFP1ExpressionMammalianMutationaa 1-82 of NM_001497.3PromoterCMVAvailable sinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-LaminB1-10
Plasmid#55493PurposeLocalization: Nuclear Envelope, Excitation: 462, Emission: 492DepositorInsertLaminB1 (LMNB1 Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBB0323-TEV-His12
Plasmid#137039Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0323 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66700.1
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Gamma-Tubulin-17
Plasmid#55485PurposeLocalization: Centrosomes, Excitation: 462, Emission: 492DepositorInsertGamma-Tubulin (TUBG1 Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-ELP-1-25
Plasmid#55478PurposeLocalization: Golgi/ER, Excitation: 462, Emission: 492DepositorInsertELP (KDELR2 Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBB0238-TEV-His12
Plasmid#137038Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0238 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66635.2
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-FYN-N-10
Plasmid#55483PurposeLocalization: Membrane Associated Kinase, Excitation: 462, Emission: 492DepositorInsertFYN (FYN Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianMutationPromoterEF1AAvailable sinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertmTQ2=mturquoise2 blue fluorescent gene
UseTagslinked to FlpO through an P2A ribosomal skipping …ExpressionMutationPromoterVillinAvailable sinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationPromoterhuman synapsin 1Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
UseTagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …ExpressionMutationNonePromoterEF1aAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCyCEN_Lisp2mCherry_hsp70_GFP
Plasmid#137169PurposeDual fluorescent reporter for liver stage expression in Plasmodium cynomolgiDepositorInsertsmCherry
Nanoluc
dihydrofolate reductase
Green Fluorescent Protein
UseUnspecifiedTagsT2AExpressionMutationPromoterP. cynomolgi hsp70 and P. cynomolgi lisp2Available sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only