We narrowed to 1,627 results for: sgrna vector
-
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NRF2
Plasmid#214692PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human NRF2DepositorInsertdgRNA_NRF2 (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEHE51
Plasmid#250522PurposeVector for sgRNA expression in Acinetobacter baumannii (CRISPRi). Modified version of pYDE007 (Plasmid #194152) made Golden Gate compatible (BsaI) for sgRNA oligo insertion.DepositorInsertTwo BsaI sites (T-BsaI-BfuI-BsaI-A) inserted between the J23119 promoter and dCas9 handle/gRNA scaffold
ExpressionBacterialPromoterJ23119Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB_sgRBBP6-68
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, human U6…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast mAtg7
Plasmid#173170PurposeRetroviral vector to express sgRNA resistant mouse Atg7DepositorInsertAutophagy Related 7 (Atg7 Mouse)
UseRetroviralMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationAll zinc fingers mutatedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgPREX1
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ54 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26
Plasmid#199265PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting mouse Rosa26 geneDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGE509
Plasmid#153281PurposeEnd-linker for cloning 3 sgRNA arrays into any recipient vectorDepositorInsertlinker
UseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE510
Plasmid#153282PurposeEnd-linker for cloning 4 sgRNA arrays into any recipient vectorDepositorInsertlinker
UseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE506
Plasmid#153279PurposeIntermediate sgRNA array cloning vector position 4DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE505
Plasmid#153278PurposeIntermediate sgRNA array cloning vector position 3DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-WT-sgNT
Plasmid#222120PurposeEIF3D overexpression vector with non-targeting sgRNADepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP
Plasmid#141210Purposeempty GFP vector for cloning sgRNA or pgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr1
Plasmid#214682PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only