We narrowed to 11,150 results for: phen
-
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-RUNX1-P2A-ERG-IMPROVED
Plasmid#154089PurposeImproved version to express RUNX1, P2A, ERG in mammalian cells.DepositorUseLentiviralExpressionMammalianPromoterTet onAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAP1
Plasmid#63674PurposeAccepts DNA sequences via BpiI cloning sites, resulting in Level 0 standard parts for Golden Gate cloning. Parts can be released with a user-defined 4-base-pair, 5 prime overhangs using BsaI.DepositorInsertRFP cloning selection cassette
UseSynthetic BiologyAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-SNAPf DHC1_IC2C_LIC2_Tctex1_Robl1_LC8
Plasmid#111903PurposeFull length human cytoplasmic dynein 1 complex, optimised for Sf9 expression. 8xHis-ZZ tag followed by TEV cleavage site and SNAPf tag on the N-terminus of dynein heavy chain 1.DepositorInsertsTags8xHis, SNAPf-tag, TEV site, and ZZ-tagExpressionInsectMutationOptimised for expression in Sf9 cells.Available SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS3 (HAUS3 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS2 (HAUS2 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS6 (HAUS6 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS7 (HAUS7 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS4 (HAUS4 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS5 (HAUS5 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS8 (HAUS8 Human, codon-optimized form for expression in Trichoplusia ni cells)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only