We narrowed to 12,390 results for: nsf
-
Plasmid#137148PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-Arch3.3-p2a-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11
Plasmid#157970PurposeAAV vector plasmid containing the Chimeric CMV/Chicken Beta Actin promoter driving 'humanized' GFPDepositorHas ServiceAAV.A01.T, AAV.A02.T, AAV.A03.T, AAV.A04.T, AAV.A05.T, AAV.A06.T, AAV.A07.T, AAV.A08.T, AAV.A09.T, AAV.A10.T, AAV.A11.T, and AAV.A12.TInsert'humanized' e.g. codon optimized GFP
UseAAVPromoterchimeric CMV/Chicken Beta actin (CBA)Available SinceOct. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP
Plasmid#137163PurposeIntersectional viral expression of ChR2-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-mSHMT2
Plasmid#83905Purposestable overexpressionDepositorInsertSerine hydroxymethyltransferase 2 (Shmt2 Mouse)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2-mCherry
Plasmid#137144PurposeIntersectional viral expression of ChR2-mCherry in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_nsp12-His6-3xFlag (SARS-CoV-2)
Plasmid#169182PurposeBaculoviral transfer vector to express nsp12-His6-3xFlag (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
TagsHis6-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-ChR2(ET/TC)-EYFP
Plasmid#137139PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-NpHR3.3-EYFP
Plasmid#137153PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-Arch3.3-EYFP
Plasmid#137149PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-Arch3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLPX-rc [Chronos-GFP]
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shCrh
Plasmid#132715PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Crh gene which encodes corticotropin releasing factorDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES Puro
Plasmid#110343Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iAChSnFR-NULL
Plasmid#137951PurposeExpresses iAChSnFR (non-binding) under hSynapsin promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140AAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only