We narrowed to 20,554 results for: Cre
-
Plasmid#193604PurposeSMARCA4 knockoutDepositorInsertsgSMARCA4 guide 1 (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTarget: Ptaq-RFP_PlacIq-GFP
Plasmid#192280PurposeRFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter PlaciqDepositorInsertsRFP
GFP
ExpressionBacterialPromoterPlacIq and PtaqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLHCX-mPM20D1-flag
Plasmid#84566Purposemouse PM20D1, C-term flag and his tags, in mammalian retroviral expression plasmid. Amp/Hygro selectionDepositorInsertpeptidase M20 domain containing 1 (Pm20d1 Mouse)
UseRetroviralTags6xHis and FlagExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
CXCR1-DuET
Plasmid#213218PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCR3-DuET
Plasmid#213199PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_GATA1_P2A_Hygro_Barcode
Plasmid#120442PurposeBarcoded lentiviral vector to express GATA1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
DRD1-DuET
Plasmid#213227PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
His6tev CBP BCHZ (1079-1751)
Plasmid#99341PurposeBacterial expression of His tagged mouse CBP HAT core Brd-ZZ (1079-1751)DepositorInsertmouse CBP BRD-ZZ domains (1079-1751) (Crebbp Mouse)
TagsHis6tevExpressionBacterialPromoterT7Available SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Str-STIM1-NN_ST-SBP-mCherry
Plasmid#65263Purposesynchronize trafficking of ST from the ER (RUSH system)DepositorInsertStr-STIM1-NN and truncated sialyltransferase (ST6GAL1 Human)
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
ID1-pLVXT
Plasmid#119280PurposeDoxycycline-inducible mouse ID1 from 806 cellsDepositorAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
GPR123-DuET
Plasmid#213262PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_EF1a-NAE1_IRES_Puro
Plasmid#235659Purposehuman NAE1 cloned into into lentiviral backbone (pLV-EF1a-IRES-Puro)DepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCas9-T2A-mApple
Plasmid#193780PurposeTricistronic expression of Cas9-mApple-BSD in mammalian cellsDepositorInsertmApple
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mIRFP670nuc-TEV-Xph20-ETWV
Plasmid#133044PurposeExpresses Xph20-ETWV in mammalian cells with nuclear miRFP670 as reporterDepositorInsertXph20-ETWV
TagsNLS, TEV protease + TEV cleavage site, and miRFP6…ExpressionMammalianMutationS63KPromoterCAGAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Az
Plasmid#197101PurposeTo express the azidophenylalanine-specific variant of Methanocaldococcus jannaschii TyrRS and its cognate amber suppressor tRNA and allow UAG codon to be translated into azidophenylalanineDepositorInsertTyrRS variant, amber suppressor tRNA, kanamycin resistance gene
ExpressionBacterialMutationThr32, Asn107, Pro158, Leu159, Gln162, Arg286 (Ty…Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CALCRL-DuET
Plasmid#213194PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR146-DuET
Plasmid#213265PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_CDC50A
Plasmid#203694Purposeexpresses CDC50ADepositorInsertTMEM30A (TMEM30A Human)
ExpressionMammalianAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only