We narrowed to 2,557 results for: GCG
-
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pmyo-3::hpo-30 gDNA (pBAB204)
Plasmid#117385PurposeAllows for body-wall muscle expression of HPO-30DepositorInsertgenomic DNA of hpo-30 (833 bp)
ExpressionWormAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (FANCC)
Plasmid#180192PurposeAAV vector carrying a guide RNA targeting the human FANCC mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiPromoterCAGAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a]
Plasmid#49333PurposeRepaired Addgene #26576 to agree with the rat ref sequence. Repairs are @: nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…PromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3-p27 T187A Luc
Plasmid#23048DepositorInsertp27 (CDKN1B Human)
TagsLuciferaseExpressionMammalianMutationT187A: mutation at codon 187 changing from T (ACG…Available SinceJan. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a] mut
Plasmid#26576DepositorInsertCACNA1D (Cacna1d Rat)
Tags6XHis and V5ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…Available SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,Δ42a] mut
Plasmid#26577DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, and 31b.Exons 32 and 42a a…Available SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGRNA2II_LacZT1
Plasmid#247079PurposeL-arabinose inducible crRNA of type I-E CRISPR cas (Escherichia coli K-12). encoding 105 nt spacer which targets Ecoli LacZ T1 siteDepositorInserttype I-E CRISPR cas crRNA
UseCRISPRExpressionBacterialAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only