We narrowed to 3,175 results for: N-EGFP
-
Plasmid#202198PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of minimal CamKIIa promotorDepositorInsertstChrimsonR, PdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP
Plasmid#50465PurposeEGFP under the control of human synapsin promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV8, AAV8 trial size, AAV9, and AAV9 trial sizeInsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-82:SON-mEGFP
Plasmid#133964PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human SONDepositorInsertSON Homology Arms with mEGFP-linker (SON Human)
UseCRISPRTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceNov. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV-SNAP-hCB1_IRES_EGFP
Plasmid#223505PurposeExpression of CB1 N-terminally fused SNAP-tag, with targeting sequence to boost plasma membrane expression. Coupled with EGFP transfection markerDepositorAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-58: NUP153-mEGFP
Plasmid#114407PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human NUP153DepositorInsertNUP153 Homology Arms with mEGFP-linker (NUP153 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-39:RAB5A-mEGFP
Plasmid#107579PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human RAB5ADepositorInsertRAB5A Homology Arms with mEGFP-linker (RAB5A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-C1-alpha1-chimaerin
Plasmid#59317PurposeExpression plasmid for GFP-tagged alpha1-chimaerin (GFP at N-terminus of alpha1-chimaerin)DepositorInsertalpha1-chimaerin
TagsGFPExpressionMammalianPromoterCMVAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-FHA
Plasmid#114129PurposeLentiviral vector for inducible expression of eGFP-RNF8 FHA domain fusion; 53BP1-independent recruitment to damaged chromatinDepositorInsertRNF8 FHA domain (amino acids 2-160) (RNF8 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianMutationaa 2-160PromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-synP-FLEX-splitTVA-EGFP-B19G
Plasmid#52473PurposeExpresses splitTVA-EGFP-B19GDepositorHas ServiceAAV1InsertTVA-P2A-EGFP-P2A-B19G
UseAAV and Cre/LoxExpressionMammalianPromoterSynapsin-1Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
phage - ubc - nls - 2xmcp - egfp - BirA*
Plasmid#131132PurposeBirA* expressed as a protein fusion with MS2 coat protein (MCP) dimer and EGFP; to visualize any MS2 tagged mRNAs and to identify the RNA proximal proteome by their biotinylation.DepositorInsertNLS-HA-2xMCP-EGFP-BirA*
UseLentiviralTagsNLS, HAExpressionMammalianMutationBirA* = BIrA >R118GPromoterhuman ubiquitin C (UBC)Available SinceAug. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-EGFP
Plasmid#108417PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-mNFM
Plasmid#32909PurposeMammalian expression construct driving the expression of a fluorescent fusion protein consisting of EGFP linked to the N-terminus of mouse neurofilament protein MDepositorAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-rNFM
Plasmid#32907PurposeMammalian expression construct driving the expression of a fluorescent fusion protein consisting of EGFP linked to the N-terminus of rat neurofilament protein MDepositorAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-NS
Plasmid#75341PurposeMultisite gateway entry clone for adding N-terminal fusions of EGFPDepositorInsertEGFP
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS8
Plasmid#218716PurposeExpresses N-terminally EGFP-tagged BBS8 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG AAV CMV HA-EGFP
Plasmid#242961PurposeAAV plasmid expressing HA-EGFP, control for plasmid 242960DepositorInsertEGFP
UseAAVTagsHAPromoterCMVAvailable SinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits