We narrowed to 7,572 results for: aav
-
Plasmid#125974PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC40Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
88_pAAV-ProA5-CatCh-GFP-WPRE
Plasmid#125889PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA5Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaCC-HA.SV40(polyA)
Plasmid#155195PurposeExpresses murine Thrombospondin-1 (THBS1) protein with deletion of Coiled Coil domain and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 276-315PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NLS-His-rsCaMPARI-mRuby3
Plasmid#122092PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus localizedDepositorInsertrsCaMPARI
UseAAVTagsNLS-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Kir2.1Mut-2A-mScarlet-KASH
Plasmid#203841Purposenon-functional Kir2.1(mutant) expression as a control for the silencing of neurons with Kir2.1 and mScarlet-KASH expressionDepositorHas ServiceAAV2InsertKir2.1 (Kcnj2 Mouse)
UseAAVTags2A-mScarlet-KASHMutationG144A, Y145A, G146AAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1617 pAAV SYN1 Nuc-EYFP
Plasmid#135567PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporterDepositorInsertsempty
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterhSYN1Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-splitTVA-EGFP
Plasmid#59332PurposeExpresses splitTVA-P2A-EGFPDepositorInsertsplitTVA950-P2A-EGFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterCAGAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-TVA-eGFP-N2cG
Plasmid#175440PurposeCre-on / Flp-off helpers for N2c rabies monosynaptic tracing; TVA, eGFP and N2cG under Synpasin promotoerDepositorInsertTVA-P2A-eGFP-P2A-N2cG
UseAAV and Cre/LoxAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [ChrimsonR-GFP]
Plasmid#118295PurposeAAV-mediated expression of ChrimsonR-GFP under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-Turbo/GFP
Plasmid#197886PurposeCan be used to generate AAV virus that will express Turbo/GFP in the presence of CreDepositorInsertTurbo/GFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA27Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn CCL20-pre-mGRASP
Plasmid#173117PurposeExpresses CCL20 sender construct in neuronsDepositorInsertCCL20-pre-mGRASP
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
45_pAAV-ProC10-CatCh-GFP-WPRE
Plasmid#125945PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC10Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-jGCaMP7c variant 1513
Plasmid#173159PurposeExpresses jGCaMP7c variant 1513 in astrocytesDepositorInsertjGCaMP7c variant 1513-WPRE
UseAAVPromoterGFAPAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-GFP]
Plasmid#128588PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pgk-DIO-rvCRY-WPRE
Plasmid#182060PurposePlasmids for production of AAV-based TFactivity reporterDepositorInsertmCherry
UseAAVPromoterhu Pgk1Available SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321A
Plasmid#115342PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321ADepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKIIa-C1V1::FusionRed::Kv2.1
Plasmid#102771Purpose"Activate neurons with 2p stimulation"DepositorInsertC1V1::FusionRed::Kv2.1
UseAAVTagsFusionRed and Kv2.1 traficking domainAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV1-EF1α-F-Flex-jGCaMP7b-WPR
Plasmid#171689PurposeFlp-dependent expression of jGCaMP7bDepositorInsertGCaMP7b
UseAAVAvailable SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
193_pAAV-ProA35-CatCh-GFP-WPRE
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA35Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC16Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-EGFP-B19G
Plasmid#59333PurposeExpresses EGFP-P2A-B19GDepositorInsertEGFP-P2A-B19G
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterSynapsin-1Available SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
194_pAAV-ProB15-CatCh-GFP-WPRE
Plasmid#125935PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB15Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
216_pAAV-ProD24-CatCh-GFP-WPRE
Plasmid#126000PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD24Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnj6
Plasmid#159913PurposeMutagenesis of Kcnj6DepositorInsertKcnj6 (Kcnj6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
27_pAAV-ProB12-CatCh-GFP-WPRE
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
131_pAAV-ProB13-CatCh-GFP-WPRE
Plasmid#125933PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB13Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
55_pAAV-ProA13-CatCh-GFP-WPRE
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger1-TS-YFP)
Plasmid#127245PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger3-TS-YFP)
Plasmid#127242PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChromeQ-GFP]
Plasmid#153540PurposeAAV-mediated expression of ChromeQ-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-SwiChR-eYFP
Plasmid#166604PurposeEncodes Cre-dependent SwiChR-eYFP under control of the TREDepositorInsertSwiChR-eYFP
UseAAVPromotertetracycline response elementAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NEO-CAG-BFP-pA-GFP-pA
Plasmid#149344PurposeVector for targeting the Replace reporter to the AAVS1 locusDepositorInsertBFP
ExpressionMammalianPromoterCAGAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321E
Plasmid#115343PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321EDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only