We narrowed to 2,760 results for: fas
-
Plasmid#89829PurposeKnockdown human Smad4 expression in human mammalian cellsDepositorInsertSmad4 shRNA (SMAD4 Mouse, Human)
UseRetroviralAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG ChR2 E123T T159C 2A tDimer
Plasmid#85399PurposeHigh efficiency channelrhodopsin with cytomegalovirus enhancer fused to chicken β-actin (CAG) promoterDepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterCAG and ribosomal skip sequence 2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.2
Plasmid#111069PurposeTo generate Adeno-Associated viruses for expression of dLight1.1 under CAG promoterDepositorHas ServiceAAV1InsertdLight1.2
UseAAVTagsFlag tagAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
nLuc_AP10_PPVs_P9mS
Plasmid#119302PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP10 connected with autoinhibitory coil P9mS and PPVs cleavage site in antiparallel harpin linker/for SPOC logicDepositorInsertsplit nLuc fused to antiparallel Coiled-coil AP10 connected with P9mS via PPV cleavable linker
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-CIB1-dCas9
Plasmid#63665PurposeMammalian gRNA expression vector also expressing CIB1-dCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTER E2F2shRNA human
Plasmid#66884PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F2DepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
B4GALT1-Dox
Plasmid#124633PurposeDoxycycline-inducible B4GALT1 expression in mammalian cellsDepositorInsertsBeta-(1,4)-Galactosyltransferase 1
Tetracycline repressor A3 mutant
TagFP635
ExpressionMammalianPromoterTRE-tight and hEF1aAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-GFP-TRIM28
Plasmid#185010PurposeEncodes gRNA for mouse TRIM28 along with Cas9 with 2A-EGFPDepositorInsertTRIM28 sgRNA (Trim28 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTER E2F3shRNA human
Plasmid#66885PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F3DepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-CR-PA-10H-SIII
Plasmid#175447PurposeHiFi-compatible destination vector for secreted overexpression of thrombin-cleavable, C-terminal Protein A-10His-TwinStrep tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTagsBiP Secretion Peptide and Thrombin-Protein A-10Hi…ExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-N-gamma-tubulin (1-333)
Plasmid#87858PurposeFluorescent fragment of gamma-tubulin that lacks gamma-tubulin DNA binding domain and NLSDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationFragment from aa 1 to 333Available SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1
Plasmid#111859PurposeFull length BICDR1 for expression in Sf9 cells. 8xHis-ZZ N-terminal tag, TEV site to cleave 8x-His-ZZ.DepositorAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-45b-NFYC-IDR-mEGFP
Plasmid#185015PurposeBacterial Expression of 6xHis NFYC IDR Sirius-GFP Fusion ProteinDepositorInsertNFYC IDR (Nfyc Mouse)
ExpressionBacterialAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA1
Plasmid#59303PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
HEL binding scFv D44.1
Plasmid#111718PurposeYeast Surface Display of D44.1 as a reference starting point for designDepositorInsertD44.1
Tagscmyc tagExpressionYeastAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGY466
Plasmid#166661PurposeFor light-inducible Cre recombinase (LiCre) expression under the Met17 promoter in yeastDepositorInsertLiCre
UseCre/LoxExpressionYeastMutationCre: E340A, D341APromoterMET17Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hFOXH1GR
Plasmid#59311PurposeForced expression of human FOXH1GRDepositorInsertFOXH1 (FOXH1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-CRY2PHR-SID4X
Plasmid#63663PurposeAAV expression of CRYS2PHR-SID4XDepositorInsertSID4X-CYR2PHR
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA3
Plasmid#59308PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-Smad3
Plasmid#89828PurposeKnockdown human Smad3 expression in human mammalian cellsDepositorInsertSMAD3 shRNA (SMAD3 Human)
UseRetroviralAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K534TAG)-HA
Plasmid#239776PurposeExpresses rat NF186 with a TAG codon at position 534 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K571TAG)-HA
Plasmid#239777PurposeExpresses rat NF186 with a TAG codon at position 571 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K604TAG)-HA
Plasmid#239778PurposeExpresses rat NF186 with a TAG codon at position 604 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K680TAG)-HA
Plasmid#239779PurposeExpresses rat NF186 with a TAG codon at position 680 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K809TAG)-HA
Plasmid#239780PurposeExpresses rat NF186 with a TAG codon at position 809 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only