We narrowed to 2,557 results for: GCG
-
Plasmid#76988Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1G2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(Tsc2-g1)-PGKpuroBFP-W
Plasmid#105039PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSK gRNA (BRDN0001149071)
Plasmid#77768Purpose3rd generation lentiviral gRNA plasmid targeting human CSKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAK-2
Plasmid#210132Purposeknock out BAK in mammalian cellsDepositorInsertBcl-2 homologous antagonist/killer (BAK1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
CSK gRNA (BRDN0001149085)
Plasmid#77767Purpose3rd generation lentiviral gRNA plasmid targeting human CSKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinFL
Plasmid#187272PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75236PurposeCRISPR/Cas9 plasmid against human NFATc1DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgCRTC2-2
Plasmid#138701PurposeExpresses a human CRTC2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRa
Plasmid#134990PurposedCas9-mediated activation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MARK1 gRNA (BRDN0001147433)
Plasmid#77794Purpose3rd generation lentiviral gRNA plasmid targeting human MARK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAP3K13 gRNA (BRDN0001145716)
Plasmid#76904Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K13DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK2
Plasmid#138689PurposeExpresses a human MARK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g1)-PGKpuroBFP-W
Plasmid#105023PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
FN3K gRNA (BRDN0001145506)
Plasmid#77431Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-shCasp2-IRES-GFP
Plasmid#52061Purposestable knockdown of Caspase-2 in mammalian cellsDepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_1
Plasmid#155077PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-0455
Plasmid#115463PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
INSR gRNA (BRDN0001145804)
Plasmid#75506Purpose3rd generation lentiviral gRNA plasmid targeting human INSRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_LacZ_sgRNA
Plasmid#155108Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMTK3 gRNA (BRDN0001148227)
Plasmid#77992Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/E2F2/NRF-1(-64)-like
Plasmid#66742Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCG(-64) to TACAPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMKK2 gRNA (BRDN0001145732)
Plasmid#76696Purpose3rd generation lentiviral gRNA plasmid targeting human CAMKK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1B gRNA (BRDN0001149482)
Plasmid#76623Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only