We narrowed to 8,684 results for: PAN
-
Plasmid#246322PurposeOverexpression of a cold-regulated gene, AtCOR6.6DepositorInsertCOR6.6-Flag
TagsFlagExpressionPlantPromoterArabidopsis actin2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG013
Plasmid#231334PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid with FRT site. L1-p15A-Gm-FRT-ELT4; GG assembly from pNDGG021, pOGG009, pNDGG006, pNDGG009, pOGG014. NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG001
Plasmid#231313PurposeVector part for BEVA; BEVA2.0 Position 4 I-SceI recognition/cut site, SpR.DepositorInsertBEVA2.0 Position 4 I-SceI recognition/cut site, SpR.
ExpressionBacterialAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM1_Euk_2NLS-WT ( LbCas12a)-2NLS
Plasmid#244836PurposeMammalian expression of wild-type LbCas12a with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a
UseCRISPRTags2xSV40 NLSExpressionMammalianPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM4_CL7_Bac_2NLS-WT (LbCas12a)-4NLS
Plasmid#244839PurposeBacterial expression of wild-type LbCas12a with 2xSV40 NLS at N-terminus and 4xSV40 at C-terminusDepositorInsertLbCas12a
UseCRISPRTags10xHis-CL7-2xSV40 NLS and 4xSV40 NLSExpressionBacterialPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM8_2CTH10_Bac_Lbm6 (LbCas12a)-4NLS
Plasmid#244843PurposeBacterial expression of Lbm6-LbCas12a with 10xHis-MBP at N-temrinus and 4xSV40 NLS at C-temrinusDepositorInsertLbm6-Cas12a
UseCRISPRTags10xHis-MBP and 4xSV40 NLSExpressionBacterialMutationD535G/S551F/D665NPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG052
Plasmid#231321PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RK2-Sp-par-ELT4; GG assembly from pOGG004, pNDGG002, pOGG010, pOGG012, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3500)
Plasmid#239237PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3547)
Plasmid#239240PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
ExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3555)
Plasmid#239242PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3572)
Plasmid#239259PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
PTPN20CP_pGCS1
Plasmid#238500PurposeIVT mRNA of human geneDepositorInsertPTPN20CP (PTPN20CP Human)
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG059
Plasmid#231325PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Tc-par-ELT4; GG assembly from pOGG004, pOGG042, pNDGG005, pOGG012, and pOGG014, TcRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SRGAP2C_pEF-DEST51
Plasmid#238497PurposeIVT mRNA of human geneDepositorInsertSRGAP2C (SRGAP2C Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDZK1P1_pGCS1
Plasmid#238501PurposeIVT mRNA of human geneDepositorInsertPDZK1P1 (PDZK1P1 Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARHGAP11B_pEF-DEST51
Plasmid#238498PurposeIVT mRNA of human geneDepositorInsertARHGAP11B (ARHGAP11B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG012
Plasmid#231333PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid with FRT site. L1-pMB1-Gm-FRT-ELT4; GG assembly from pNDGG021, pOGG009, pNDGG007, pNDGG009, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG005
Plasmid#231332PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI-ELT4 counterselectable site for BpiI cloning. L2-P15A-Gm-ISceI-ELT4; GG assembly from pOGG006, pOGG009, pNDGG006, pGQ0023, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG004
Plasmid#231331PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Gm-ISceI-ELT4; GG assembly from pOGG004, pOGG009, pNDGG006, pGQ0023, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG058
Plasmid#231326PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Sp-par-ELT4; GG assembly from pGQ0015, pNDGG002, pNDGG005, pOGG012, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG056
Plasmid#231324PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Gm-par-ELT4; GG assembly from pGQ0015, pOGG009, pNDGG005, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG070
Plasmid#231328PurposeBEVA Golden Gate cloning vector; BEVA2.0 Sucrose curable broad host range plasmid . L1-pBBR1-Sp-sacB-ELT4; GG assembly from pOGG004, pNDGG002, pOGG011, pNDGG008, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG049
Plasmid#231318PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. -pBBR1-Gm-par-ELT4; GG assembly from pOGG004, pOGG009, pOGG011, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG021
Plasmid#231305PurposeVector part for BEVA; BEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpRDepositorInsertBEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpR
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG008
Plasmid#231312PurposeVector part for BEVA; BEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.DepositorInsertBEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG002
Plasmid#231329PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Nm-ISceI; GG assembly from pOGG004, pNDGG001, pNDGG006, pGQ0023, pOGG014. KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pACEBac1_Strep-Psc-BICD2(1-400)
Plasmid#228830PurposeInsect cell expression of N-terminal portion of BICD2 (aa 1-400)DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1_Strep-Psc-BICD2(1-710)
Plasmid#228831PurposeInsect cell expression of truncated BICD2 (aa 1-710)DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK468 (BSD-P2A-mAID-dTAG)
Plasmid#214394PurposemAID-dTAG for N-terminal taggingDepositorInsertBSD-P2A-mAID-dTAG
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK452 (BSD-P2A-dTAG-mClover)
Plasmid#214382PurposedTAG-mClover for N-terminal taggingDepositorInsertBSD-P2A-dTAG-mClover
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gfp
Plasmid#212136PurposeCargo plasmid for integrating PT7 expression cassette of green fluorescent protein in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertgreen fluorescent protein
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_CbFDH
Plasmid#212140PurposeCargo plasmid for integrating PT7 expression cassette of formate dehydrogenase in genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertformate dehydrogenase
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only