We narrowed to 24,925 results for: crispr
-
Plasmid#61051Purposefor generation of a eGFP specific sgRNA from a T7 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP sgRNA
UseCRISPRPromoterT7Available sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCjeCas9
Plasmid#172215PurposeExpresses Campylobacter jejuni Cas9 (CjeCas9) in bacterial cellsDepositorInsertCas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagPromoterT7Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE046-SiT-Cas12a-[Repr]
Plasmid#128132PurposeExpress both AsCas12a fused to [Repr] repressor domain and CRISPR arrays on a single transcriptDepositorInsertAsCas12a-[Repr]-Triplex
UseAAVExpressionMammalianAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSL0527 (pDonor)
Plasmid#130634PurposeEncodes a mini-transposon derived from V. cholerae CAST system, with CmR cargo gene. Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (Mini-Tn)
UseCRISPR; TransposonExpressionBacterialAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-sgCXCR4-2
Plasmid#46917PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CXCR4 geneDepositorInsertsUseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS73_10xHis_MBP_TEV_SpRY-Cas9_2xNLS
Plasmid#244835PurposeBacterial expression of SpRY Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags2xSV40 NLS and 10xHis-MBPExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBECAb-apr
Plasmid#122001PurposeA cytidine deaminase-mediated base-editing plasmid in Acinetobacter baumanniiDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMEH305 HA NLS SpCas9 3x high affinity MS2 loops
Plasmid#168216PurposeMammalian expression SV40 and nucleoplasmin NLS SpCas9 with 3 high affinity MS2 loops and fused to an N-terminal HA tagDepositorInsertSV40 NLS SpCas9
UseLentiviralTagsHA, SV40 NLS, and nucleoplasmin NLSExpressionMammalianPromoterCMVAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p46Cpf1-OP2
Plasmid#98592PurposeProduces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli.DepositorInsertFnCpf1
UseCRISPRExpressionBacterialMutationCodon optimized for E. coliPromoteraraBADAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
evoCas9
Plasmid#138558PurposeExpresses human codon-optimized evolved SpCas9 and blasticidin resistance: EFS promoter-evoCas9-NLS-FLAG-P2A-BSDDepositorInsertevoCas9
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationM495V, Y515N, K526E, R661QPromoterEFSAvailable sinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRM055 His-TEV-Cas9 6xNLS 0C
Plasmid#196246PurposeExpression of NLS-rich Cas9 (0 Cys residues, mammalian codon optimized)DepositorInsertCas9
ExpressionBacterialPromoterT7Available sinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide_DKO
Plasmid#183193PurposePlasmid with two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-hCas3
Plasmid#134920PurposeComponents for genome editing in mammalian cells with pCAG-All-in-one-hCascade and pBS-U6-crRNA-targeted.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas3 with bpNLS
ExpressionMammalianPromoterCAGAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lenti EF1a-FLAG-dCas9-VPR
Plasmid#114195PurposeLentivirus compatible dCas9-VPR construct driven by the EF1a promoterDepositorInsertdCas9-VPR
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CBE6b-SpRY
Plasmid#257826PurposeCBE6b Sp Cas9 SpRY IVT plasmidDepositorInsertsCBE6b SpCas9 SpRY
CBE6b Sp Cas9 SpRY
ExpressionMammalianAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
sgOpti
Plasmid#85681PurposeLentiviral vector to express sgRNAs. The cloning site is BsmBI.DepositorPublicationTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by