We narrowed to 8,878 results for: tre promoter
-
Plasmid#210319PurposeExpresses SARS-CoV-2 NSP4 fused with mCherry in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
UseTagsmCherryExpressionMammalianMutationMany synonymous changes due to codon optimizationPromoterAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgVRK1-hygro
Plasmid#199640PurposesgRNA guide against VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_ZFP64_Delta_TAD
Plasmid#118698PurposeExpress ZFP64 without transcription activation domain(TAD)DepositorInsertZFP64_Delta_TAD (ZFP64 Human)
UseLentiviralTags3XFLAG was fused to the N terminal of ZFP64 cDNAExpressionMutationDelete amino acid from 453 to 681PromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC
Plasmid#200558PurposeSecreted mouse CES2A driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagExpressionMutationPromoterTBG promoterAvailable sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2201
Plasmid#115449PurposeConstitutive lentiviral expressionDepositorInsertsgQKI-2201 (QKI Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2204
Plasmid#115450PurposeConstitutive lentiviral expressionDepositorInsertsgQKI-2204 (QKI Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-MCS2-EF1-Puro-RGS7
Plasmid#113728PurposeExpress RGS7 in mamalian cellsDepositorInsertRGS7 (RGS7 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgSNAI1-2097
Plasmid#115453PurposeConstitutive lentiviral expressionDepositorInsertsgSNAI1-2097 (SNAI1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgRBFOX1-2098
Plasmid#115452PurposeConstitutive lentiviral expressionDepositorInsertsgRBFOX1-2098 (RBFOX1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgRBFOX1-2083
Plasmid#115451PurposeConstitutive lentiviral expressionDepositorInsertsgRBFOX1-2083 (RBFOX1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorInsertTRX (w Fly)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
UseTags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDT2:GUS
Plasmid#108444PurposeArabidopsis transformation, expresses HDT2 promoter/GUS fusion to study expression pattern in rootsDepositorInsertHDT2 promoter (HD2B Mustard Weed)
UseTagsGUSExpressionPlantMutationPromoterHDT2Available sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
yeast_DualReporter
Plasmid#127546PurposeA dual reporter vector modified from Sharon et al (Nature Biotech, 2012) containing Ura3 and Nat1 selectable markers, a constant background RFP (TEF2::mCherry), and a variable YFP (pTpA+MCS::yEVenus).DepositorInsertsUseSynthetic BiologyTagsExpressionYeastMutationPromoterTEF, TEF2, URA3, bla (E. coli), and pTpA+MCSAvailable sinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorInsertMICB*005 (MICB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorInsertMICA*009 (MICA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
UseTagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL2del
Plasmid#216742PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 2 (OL2) by examining the variant lacking OL2 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [LEDSGYMA…PromoterAvailable sinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL4del
Plasmid#216744PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 4 (OL4) by examining the variant lacking OL4 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 4 (OL4) with the sequence of [TLDGKPVQ…PromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL5del
Plasmid#216745PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 5 (OL5) by examining the variant lacking OL5 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 5 (OL5) with the sequence of [ATFAA] i…PromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL1del
Plasmid#216741PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 1 (OL1) by examining the variant lacking OL1 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 1 (OL1) with the sequence of [INIGGALQ…PromoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1213 - pL0_p16OMT (pro + 5U)
Plasmid#203890Purpose16OMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsert16OMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1214 - pL0_pNMT (pro + 5U)
Plasmid#203893PurposeNMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertNMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-EGFP
Plasmid#122956PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xhis tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd1-NLS-3XFLAG-V5
Plasmid#196092PurposeExpresses mouse SAFB lacking the first computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 96-285 (predicted disordered …PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd3-NLS-3XFLAG-V5
Plasmid#196094PurposeExpresses mouse SAFB lacking the third computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 638-925 (predicted disordered…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-DD3-NLS-3XFLAG-V5
Plasmid#196095PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationContains only AA 619-925 (NLS and predicted disor…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-ATOH1 (SA Substitutions)
Plasmid#172309PurposeIn vitro transcription of ATOH1 (Ser phosphosites substituted by Ala)DepositorInsertATOH1 (ATOH1 Human)
UseOtherTagsExpressionMutationS331A, S342APromoterT7 promoter A-initiatingAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta EGF repeats (N2NL-delta EGF)-ires-EGFP
Plasmid#122955PurposeLentiviral expression of NOTCH2NL delta EGF repeats under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta EGF repeats (NOTCH2NLB Human)
UseLentiviralTags6xhis tagExpressionMutationdeletion of EGF repeats from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenWT-Puro
Plasmid#135676PurposeConstitutive expression (cMV promoter) of wildtype Pten cDNA, Puromycin selectionDepositorInsertPten (Pten Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only