We narrowed to 36,576 results for: kan
-
Plasmid#29559DepositorAvailable SinceOct. 7, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pET His6 ProteinG TEV LIC cloning vector (1P)
Plasmid#29660DepositorTypeEmpty backboneTags6xHis, Protein G, and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
FCHo1-pmCherryC1
Plasmid#27690DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
Nampt-PET28a
Plasmid#25630DepositorAvailable SinceAug. 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
TrHKII-pGFPN3
Plasmid#21921DepositorInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pENTR/pSM2(CMV) (w57-1)
Plasmid#17389PurposeGateway entry vector for miRNA expression under CMV promoterDepositorTypeEmpty backboneUseGateway Cloning and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEX-SP-YFP-STIM1(D76A)
Plasmid#18859DepositorInsertStromal interaction molecule 1 (STIM1 Human)
TagsYFPExpressionMammalianMutationD76A mutation - changed aspartate 76 to alanine. …Available SinceOct. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLTR-G
Plasmid#17532DepositorInsertVSV-G glycoprotein (Indiana strain)
UseLentiviralExpressionMammalianAvailable SinceApril 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
PECAM-eGFP
Plasmid#14688DepositorAvailable SinceMay 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-N1 RanGAP
Plasmid#13386DepositorAvailable SinceNov. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBD-0001
Plasmid#12373DepositorAvailable SinceAug. 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
L1T10 - T2PB/pUBQ10 (mTagBFP2, mCherry, NeonGreen)
Plasmid#219687PurposeLevel 1 History-dependent target, switch PhiC31 then Bxb1, pUBQ10 promoter, and output: mtagBFP2 then mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PB/pUBQ10 (mTagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
L1T18 - T2PsB/p35S preswitched (mTagBFP2, mCherry, NeonGreen)
Plasmid#219690PurposeLevel 1 preswitched History-dependent target, switch with Bxb1, p35S promoter, and output: mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PsB/p35S (mTagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
L1T9 - T2PB/p35S (mTagBFP2, mCherry, NeonGreen)
Plasmid#219686PurposeLevel 1 History-dependent target, switch PhiC31 then Bxb1, p35S promoter, and output: mtagBFP2 then mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PB/p35S (mTagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINIT_kan
Plasmid#46973PurposeFX sequencing vector for subcloning, kanamycin markerDepositorTypeEmpty backboneUseSequencing vectorPromoternoneAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGM202T7
Plasmid#69993PurposeE. coli/Streptomyces expression vector containing the T7-promoterDepositorInsertsaphII
tsr
rep
sso
T7 promoter
dso
His-Orf
TagsN-terminal and C-terminal His tag encoding sequen…ExpressionBacterialAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
L1T15 - T2PsB (mtagBFP2, mCherry, NeonGreen)
Plasmid#219689PurposeLevel 1 preswitched History-dependent target without promoter, switch by Bxb1, output: mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PsB (mtagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKanCMV_mRuby3
Plasmid#172854PurposemRuby3 expressed under the CMV promotorDepositorInsertmRuby3
ExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
L1T11 - T2BP/p35S (BFP, mCherry, NeonGreen)
Plasmid#219688PurposeLevel 1 History-dependent target, switch Bxb1 then PhiC31, p35S promoter, and output: mtagBFP2 then mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2BP/p35S (BFP, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only