We narrowed to 6,212 results for: cas9 expression plasmid
-
Plasmid#133797PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1(T16A) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1(T16A)
UseTagsNLS(SV40)ExpressionMammalianMutationT16APromoterCMV and T7Available sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-Leu-NLS(SV40) (KAC440)
Plasmid#133799PurposeCMV and T7 promoter expression plasmid for human codon optimized Leu-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Leu-AcrIIA1
UseTagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-Eriv-NLS(SV40) (KAC442)
Plasmid#133800PurposeCMV and T7 promoter expression plasmid for human codon optimized Eriv-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Eriv-AcrIIA1
UseTagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-PJ23119-PplpT-sfGFP-TrrfB-BsaI-Scaf-L2
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUG-natNT2
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
UseTagsExpressionBacterial and YeastMutationPromoterAgTEF1Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only