We narrowed to 5,870 results for: RIK
-
Plasmid#122303PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic, Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-Flag-Snrnp40
Plasmid#134249PurposeLentivector encoding Flag-tagged Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK2 mouse (Sik2 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK2 mouse (Sik2 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-H2-Dd (Y84C/C121S/A139C)
Plasmid#136063PurposeMammalian expression of myc-tagged H2-Dd (Y84C/C121S/A139C mutant)DepositorInsertH2-Dd (H2-D1 Mouse)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationY84C/C121S/A139CPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B15-VN
Plasmid#135514PurposeMammalian expression of VN-fused and myc-tagged HLA-B*15:01DepositorInsertHLA-B*15:01 (HLA-B Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B57-VN
Plasmid#135515PurposeMammalian expression of VN-fused and myc-tagged HLA-B*57:01DepositorInsertHLA-B*57:1 (HLA-B Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B8-VN
Plasmid#135511PurposeMammalian expression of VN-fused and myc-tagged HLA-B*08:01DepositorInsertHLA-B*08:01 (HLA-B Human)
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-CjeCas9-TLR-MCV1-sgRNA
Plasmid#117408PurposeCjeCas9 sgRNA targeting TLR2.0DepositorInsertCjeCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SauCas9-TLR-MCV1-sgRNA
Plasmid#117409PurposeSauCas9 sgRNA targeting TLR2.0DepositorInsertSauCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-LbCas12a-TLR-MCV1-gRNA
Plasmid#117410PurposeLbCas12a-gRNA targeting TLR2.0DepositorInsertLbCas12a gRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-NmeCas9-TLR-MCV1-sgRNA
Plasmid#117407PurposeNmeCas9 sgRNA targeting TLR2.0DepositorInsertNmeCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
AdMKP-3 S159A
Plasmid#131520PurposeExpresses MKP-3 with S159A mutation in mammalian cellsDepositorInsertMitogen-activated protein kinase phosphatase 3 (Dusp6 Mouse)
UseAdenoviralTagsNoExpressionMutationchanged Serine 159 to AlaninePromoterCMVAvailable sinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pggt1b-g1)-PGKpuroBFP-W
Plasmid#105018PurposeLentiviral gRNA plasmid targeting mouse Pggt1b , co-expression of TagBFPDepositorInsertPggt1b (Pggt1b Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Znrf1-g1)-PGKpuroBFP-W
Plasmid#105020PurposeLentiviral gRNA plasmid targeting mouse Znrf1 , co-expression of TagBFPDepositorInsertZnrf1 (Znrf1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-RNF68 [dRING]
Plasmid#126549PurposeExpresses FLAG-HA-tagged RNF68 [dRING mutant] in mammalian cellsDepositorInsertRNF68 (PCGF1 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationRING domain deletion mutant [dRING mutation is a …PromoterLTRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-RNF68 [Y252D]
Plasmid#126550PurposeExpresses FLAG-HA-tagged RNF68 [Y252D] mutant in mammalian cellsDepositorInsertRNF68 (PCGF1 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationY252D point mutantPromoterLTRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Tbkbp1 1-280
Plasmid#125178PurposeRetroviral expression of mouse Tbkbp1 (1-280)DepositorInsertTbkbp1 (Tbkbp1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationContains amino acids 1-280PromoterCMVAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Tbkbp1 1-330
Plasmid#125179PurposeRetroviral expression of mouse Tbkbp1 (1-330)DepositorInsertTbkbp1 (Tbkbp1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationContains amino acids 1-330PromoterCMVAvailable sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CH111-QES.c13.L544Y-754*
Plasmid#123264PurposeMammalian expression plasmid for Env from the CH111 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-001428-QES.c10.L544Y-754*
Plasmid#123253PurposeMammalian expression plasmid for Env from the 001428 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (001428) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-AD8-QES.i08.c04-754*
Plasmid#123258PurposeMammalian expression plasmid for Env from the AD8 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-001428(753)-VC
Plasmid#123256PurposeMammalian expression plasmid for Env from the 001428 HIV-1 isolate; C-terminal truncation fused to the C-terminal half of split fluorescent Venus (VC)DepositorInsertHIV-1 (001428) Env
UseTagsCD5 leader peptide and VC (Venus residues D155–K2…ExpressionMammalianMutationCodon-optimized synthetic gene; C-terminal Env re…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-ZM197M-QES.c10-754*
Plasmid#123222PurposeMammalian expression plasmid for Env from the ZM197M HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (ZM197M) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842-QES.i04.c05
Plasmid#123233PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q842.d12) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Mutations P124D, …PromoterCMVAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaL-QES.i01.c08-754*
Plasmid#123213PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SHIV327C-HuA10-QES.i09.c07
Plasmid#123269PurposeMammalian expression plasmid for Env from the SHIV327C-Hu A10 strain; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertSHIV327C-Hu A10 Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Mutations V208M, …PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422-QES.c12-754*
Plasmid#123249PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-B41gp160-V200E-754*
Plasmid#123244PurposeMammalian expression plasmid for Env from the B41 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (B41) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-QES.i06.c07-754*
Plasmid#123238PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (191084 B7-19) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-25711-QES.c11-754*
Plasmid#123218PurposeMammalian expression plasmid for Env from the 25711 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (25711) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842gp160-QES.i04.I181L
Plasmid#111837PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; QES mutant with enhanced binding to antibody PG16DepositorInsertHIV-1 (Q842.d12) Env
UseTagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations P124D;I…PromoterCMVAvailable sinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHTSHP-ShhN-Cys
Plasmid#121136PurposeExpresses ShhN with a C-terminal cysteine residues in bacteriaDepositorInsertshh (Shh Mouse)
UseTagsHIS, HRV3C site, and MBPExpressionBacterialMutationAmino acid sequence from 26-191, with an addition…PromotertacAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE
Plasmid#120394PurposepAAV plasmid expressing Diras2 shRNA2 under the U6 promoter and mCherry.3XFLAG under the hSyn promoterDepositorInsertDiras2 shRNA (Diras2 Mouse)
UseAAV and RNAiTagsmCherry.3XFLAGExpressionMutationPromoterU6Available sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS592-pCSDest2-AcrIIC4Hpa-BFPv2-IRES
Plasmid#113438PurposeExpresses type II-C anti-CRISPR protein from H. parainfluenzae and a BFP from IRES in mammalian cellsDepositorInsertsType II-C anti-CRISPR
mTagBFP2
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS593-pCSDest2-AcrIIC5Smu-BFPv2-IRES
Plasmid#113439PurposeExpresses type II-C anti-CRISPR protein from S. muelleri and a BFP from IRES in mammalian cellsDepositorInsertsType II-C anti-CRISPR
mTagBFP2
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-mOC-STAMP (N162D)-GFP
Plasmid#73580PurposeLentivirus expression of mOC-STAMP with N162D mutationDepositorInsertOC-STAMP (Ocstamp Mouse)
UseLentiviralTagsGFPExpressionMutationchanged asparagin (N) 162 to Aspartic Acid (D)PromoterAvailable sinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb1(S)-Fc-His
Plasmid#72127PurposeExpresses the N-terminal extracellular region of the PlexinB1 protein following proteolytic cleavage (ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb1 (Plxnb1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.6-Fc-His
Plasmid#72103PurposeExpresses the extracellular region of the Neuropilin 2, isoform 6 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNrp2.6 (Nrp2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.2-Fc-His
Plasmid#72099PurposeExpresses the extracellular region of the Neuropilin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNrp2.2 (Nrp2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.e-Fc-His
Plasmid#72114PurposeExpresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng1.e (Ntng1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.g-Fc-His
Plasmid#72116PurposeExpresses the extracellular region of the Netrin G1, isoform g protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng1.g (Ntng1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-Fc-His
Plasmid#72113PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng1.d (Ntng1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.b-Fc-His
Plasmid#72121PurposeExpresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng2.b (Ntng2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.g-AP-His
Plasmid#71990PurposeExpresses the extracellular region of the Netrin G1, isoform g protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.g (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.c-AP-His
Plasmid#71986PurposeExpresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.c (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.f-AP-His
Plasmid#71989PurposeExpresses the extracellular region of the Netrin G1, isoform f protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.f (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.b-AP-His
Plasmid#71985PurposeExpresses the extracellular region of the Netrin G1, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.b (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only