Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 929 results for: KIN

Showing: 101 - 150 of 929 results

  1. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...

  2. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...IgG2a 220411 LRRK2/Dardarin kinase, C-terminus [N241A/58R] LRRK2/Dardarin kinase, C-terminus Human Mouse ...several protocols available that may be helpful for working with R-mAbs expressed from the plasmids in this...

  4. Recombinases AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  5. AAV for Neuronal Tracing

    Type
    Collection
    ...):639-47. PMID: 17329205 Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  8. Chemogenetics AAV Preps

    Type
    Collection
    ...Browse all Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  9. Antibody Plasmid Collection

    Type
    Collection
    ...102. Joanna Bereta Sybody Generation Toolbox for making synthetic nanobodies (sybodies) against membrane...

  10. AAV Packaged on Request

    Type
    Collection
    ...experiments. Shipping 2–7 days We will email you with tracking information as soon as your order ships. Shipping...

  11. Lentiviral Prep Service

    Type
    Collection
    ...Viral Service Suggestions Don’t see what you are looking for? Please let us know what you would like to ...

  12. Arf GTPase Family

    Type
    Collection
    ... the archaeal origins of Eukaryotic Membrane-Trafficking System building blocks. Molecular Biology and...

  13. Viral Vectors

    Type
    Collection
    ...Resources The NIH provides basic guidelines for working with various types of viruses; however, these guidelines...

  14. Zebrafish Plasmid Collection

    Type
    Collection
    ...Browse Plasmids Plasmid Tools for Use in Zebrafish Looking for plasmids containing your zebrafish gene of ...

  15. Control AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  17. CRISPR References and Information

    Type
    Collection
    ...protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic Deletions in Mammalian...

  18. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGCCTGGCACAGGGGCTctccaccatgctggccAACCTGTTCTCAATGA kinesin-family-member-13a TAL3106 & TAL3107 TGTTCTCTGTTTGAGCGAgtctccacacagcagaGCGACAGTAACAGCTTCA...

  19. Optogenetics AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  20. Plan Your Experiment

    Type
    Collection
    ... the observed efficiency of CRISPR knockout or knockin. Select gene and genetic element to be manipulated...

  21. Retrograde AAV viral preps

    Type
    Collection
    ...of California, Berkeley). Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  22. Caltech Systemic Capsids

    Type
    Collection
    ...Link opens in a new window) Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  23. Biosensor AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you...

  25. Optogenetics Guide

    Type
    Guide
    ...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted...CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent amplitude 490 ChR/T159C...activity 589 eNpHR 3.0 NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide...sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated ... Arch. 566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins...

  26. Molecular Biology Reference

    Type
    Guide
    ...Origins of Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E....to break chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists...primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...entry vectors and TOPO cloning vectors. If you are looking for an empty plasmid backbone for your experiment... number of E. coli strains below and recommend checking out these two Addgene blog posts relating to common...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin...

  27. CRISPR Guide

    Type
    Guide
    ...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living... the most scalable genome editing technologies, making CRISPR perfect for genome-wide screens. This guide...very close proximity to the region to be edited, making the PAM sequence (NGG) limiting. This PAM is abundant...inhibit CRISPR by a variety of mechanisms, including blocking crRNA loading or PAM recognition; inhibiting Cas9...sites is sufficient to repress transcription by blocking initiation. More robust transcriptional repression...repression through cytosine methylation with improved kinetics LSD1 - repression through targeted removal of ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...

  28. Chemogenetics Guide

    Type
    Guide
    ...exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer Receptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at... workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter bioluminescent...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine’s actions? Psychopharmacology. 178:451...opens in a new window) Slaviero AN, Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO, Prakash M, ...

  29. Adenovirus Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...response in different ways, such as expressing cytokines and other immune-modulatory molecules. Another...occur with contact to mucous membranes or broken skin. The risk of exposure and reaction severity is increased... He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein, B. (1998). A simplified system... J., Sharff, K. A., Luu, H. H., Haydon, R. C., Kinzler, K. W., Vogelstein, B., & He, T. C. (2007). A protocol...

  30. Antibody Guide

    Type
    Guide
    ...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes...

  31. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...choice for the delivery of CRISPR/Cas9 elements, making it one of the most common methods for in vivo CRISPR-based...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...pioneering solutions for human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https:/...

  32. Sequencing Primers

    Type
    Guide
    ...Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT...

  33. Cloning

    Type
    Guide
    ... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ...

  34. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...

  35. Lentiviral Vector Guide

    Type
    Guide
    ...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...

  36. Promoters

    Type
    Guide
    ...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...

  37. Plan Your Experiment

    Type
    Guide
    ... the observed efficiency of CRISPR knockout or knockin. Select gene and genetic element to be manipulated...

  38. Immunocytochemistry

    Type
    Protocol
    ...PBS on a rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform...PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform...platform in 500 µL blocking buffer. Remove the blocking buffer and dispose of it in an appropriate waste container...PBS on a rocking platform. (Optional) Counterstain nuclei with 500 µL of 300 nM DAPI working solution ...Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10...buffer: Dilute 20 µL of Triton X-100 in 10 mL PBS. Blocking buffer: Dilute 0.5 g BSA and 30 µL Triton X-100... 150 µL Triton X-100 in 50 mL PBS. 300 nM DAPI working solution: Prepare a 300 µM DAPI stock solution ...

  39. Western Blot

    Type
    Protocol
    ...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... at RT on a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare...information specific to your antibody, such as ideal blocking buffer and optimal antibody concentrations. Consider...When the run is complete, select Done. Section 5: Blocking Prepare 1X TBST as follows: 25 mL of 20X TBS 2.5...20 472.5 mL of deionized water Mix well Prepare blocking buffer as follows: Dilute 5% w/v non-fat milk ...milk into 100 mL of 1X TBST. Pro-Tip The ideal blocking buffer will vary between antibodies. Refer to ... 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6: Antibody incubation Dilute the primary...

  40. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... some times when you may be working with a protocol that requires shaking or mixing, which may produce...safety guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...safety requirements. BSL-1 is designated for those working with microbes that don’t cause disease in healthy...equipment (PPE) and wear it the whole time you are working in the lab. Do not eat, drink, chew gum, or apply...work at your lab bench. It’s possible that while working, you may accidentally come into contact with hazardous...into your eyes. Wash your hands before and after working in the lab. Ensure that a designated chemical waste...safety training before starting the work. Before working with chemicals, first review their material safety...

  41. Video Library

    Type
    Protocol
    ...Protocol Streaking Bacteria on Plates Isolate single bacterial colonies on an agar plate Streaking Bacteria...new window) Video Link Description Related Page Making LB Agar Plates Create plates to culture bacteria...Started with Tissue Culture Tips and tricks for working with tissue culture in the lab. Blog post: 10 Basic...clean workspace, and maintaining sterility while working. AAV Titration by qPCR Use qPCR to measure the ...students considering their future careers. Eric J. Perkins, PhD In this installment, we sit down with Senior...Senior Scientific Project Leader Eric Perkins to discuss the various positions he has held in his career...the works, and all of the things she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's...

  42. Protocol - How to Streak a Plate

    Type
    Protocol
    ... Protocols Streaking Bacteria on LB Agar Plate Streaking and Isolating Bacteria on an...an LB Agar Plate You may also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid...explains how to isolate a single bacterial colony by streaking it onto an LB agar plate. Last Update: Feb. 28...down with a paper towel. Maintain sterility by working near a flame or bunsen burner. Obtain the approrpriate...technique is to draw in discontinuous lines. Start by streaking a vertical line of bacteria along one edge of ...

  43. Protocol - Bacterial Transformation

    Type
    Protocol
    ...to isolate single bacterial colonies. Equipment Shaking incubator at 37 °C Stationary incubator at 37 °... microcentrifuge or falcon tube. GENTLY mix by flicking the bottom of the tube with your finger a few ...without antibiotic) to the bacteria and grow in 37°C shaking incubator for 45 min. Pro-Tip This outgrowth step...fast and easy to use, but are less efficient at taking up larger plasmids. If you need to transform large...to ensure that your transformation procedure is working. TIP: Sometimes less is more. Although it may be...

  44. Pouring LB Agar Plates

    Type
    Protocol
    ...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Bleocin...appropriate sterilization technique if you are working with any weird and wonderful organisms. While your...station: Find an empty section of lab bench with a working flame. Spray down the bench with a 70% ethanol ...stop pouring and re-make the gel-mix. If you’re making plates without any antibiotic you can alternatively...viable. You can check for this possibility by streaking out both strains on plates without any antibiotic...

  45. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...Microcentrifuge Electrophoresis chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic...deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the sink. Add 20...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue SafeStain in ...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Add 100...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Take ...

  46. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector ...the transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R...it has been diluted. Mix by swirling or gently flicking the tube. Incubate for 5 minutes at room temperature...the walls of the tube. Mix by swirling or gently flicking the tube. f. Incubate for 20-30 minutes at room...errors may occur. Addgene makes no warranty of any kind regarding the contents of any literature. Literature...IS” “AS AVAILABLE” basis without warranty of any kind either expressed or implied, including but not limited...

  47. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...same location. Looking at the trace file will give you more information than simply looking at the bases.... You can find Addgene's sequencing results by clicking on the "View Sequences" link on the Plasmid Information...results may indicate bases at specific locations, by looking at the trace file, you will see that these base...

  48. Weighing Reagents Protocol

    Type
    Protocol
    ... or other solutions. A key part of this task is making sure you’re weighing all reagents precisely to ...capacity for the material that you are weighing by looking for a weight range on the scale. Make sure that...how to properly dispose of reagents that you are working with. Pro-Tip When you weigh out a reagent, you...you have your reagents weighed out, you can begin making your solutions!...

  49. Lentivirus Production

    Type
    Protocol
    ...There can be batch to batch variation when making the PEI working stock, therefore the ratio of μg DNA:μg...After 2 months, discard the tube and thaw a new working stock. The optimal mass DNA:mass PEI ratio will...mixture. Add the diluted PEI dropwise while gently flicking the diluted DNA tube. Incubate the mixture 12–...

  50. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...add 385µl of water. After making your 100uM stock, immediately make a working concentration of each primer...primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of primer stock to 900µl of...cloning purposes. What do I do if my PCR isn't working? Try adding 1µl of 25mM MgCl 2 and/or 1µl DMSO ...
Showing: 101 - 150 of 929 results