We narrowed to 876 results for: lic
-
TypeCollection...sensor, cytosolic or ER-targeted eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and ...and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem Biol. 2013 ...:7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic AMP (cAMPr) for mammalian or insect...sensor for cyclic AMP. Sci Signal. 2018 Mar 6;11(520). pii: 11/520/eaah3738. Justin Blau cAMP (cyclic AMP) ...:4003-4012.e6. Xavier Nicol cyclic di-GMP FRET-based biosensor for cyclic-di-GMP measurement Asymmetrical...Fluorescent biosensor of the cytosolic NADH/NAD+ redox state Imaging Cytosolic NADH-NAD(+) Redox State with...protein for NADH/NAD+ ratio Cytosolic NADH-NAD Redox Visualized in Brain Slices by Two-Photon Fluorescence...
-
Antibody Guide
TypeCollection...single assay. Overview of Antibody Applications Antibody-based applications can be generally classed into ...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...production and storage techniques, and explain common applications. Science... Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods...of other antibodies. This has useful research applications, and is covered in the following Isotypes section...signaling molecules and are often used in clinical applications. Diabodies - Diabodies contain two Fab fragments... molecules that can be distinguished in your application. The indirect detection method uses an unconjugated... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 H840A nickase fused to a reverse...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Epigenetics To make targeted epigenetic modifications... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...each of the above serotypes and buffers. Please click on the plasmid name for ordering information. ID...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495.... -
CRISPR Guide
TypeCollection...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting... every genomic target. Due to its comparative simplicity and adaptability, CRISPR rapidly became the most... to various Cas enzymes have extended CRISPR applications to increasingly complex functions, including...understanding of CRISPR biology, introduce the various applications of CRISPR, and help you get started using CRISPR... Cas12a, which are available for specialized applications. Check out our list of additional Cas proteins...genomic edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using...to help you select an optimized gRNA for your application (see: gRNA Design Software ). In addition to ... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection...Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication Return to ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Return to top C. elegans ID Plasmid Gene/Insert Promoter Selectable...Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker ...Marker PI Publication Return to top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Parasite ID Plasmid Gene/Insert...Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources Addgene has a large selection... -
CRISPR Plasmids - Bacteria
TypeCollection...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication RNA Targeting Type VI CRISPR systems, including... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...headings. Click on the publication link to view all other plasmids from that article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table ...Description Vector Type Selectable Marker PI Publication Back to Top Do you have suggestions for other... -
Luciferase Plasmid Collection
TypeCollection... of applications. To learn more and plan your experiment, check the plasmid's original publication or ...luciferases in our collection include the red and green Click-beetle luciferases ( CBRluc and CBGluc , respectively...advantages and disadvantages depending on the application, and different luciferases require different ... course experiments, but is too dim for some applications. NanoLuc® is small (19 kDa), very bright, and...Koen Venken 133315 pMKV060 Firefly AtUbi10 BeYDV replicon on T-DNA backbone expressing firefly luc for monitoring...Daniel Voytas 133312 pMKV057 Firefly AtUbi10 BeYDV replicon on T-DNA backbone expressing WUS2 and IPT, with...OgNLuc ) fusions for BRET-based imaging and other applications. And see PalmGRET , a membrane-anchored version... -
CRISPR History and Development for Genome Engineering
TypeCollection...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s clear...just as useful (if not more so) for research applications, eclipsing past genome engineering technologies...for CRISPR genomic editing. Genome Engineering Applications In 2012, Jinek et al. first demonstrated that... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool...various species, as well as the development of new applications. The first CRISPR papers described two main ...RNA, making it a very flexible system. Other Applications Scientists have also used the targeting capability...Biotechnology companies are exploring therapeutic applications of CRISPR to treat genetic disease, with the... -
CRISPR Plasmids - Yeast
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Description Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
mTOR Pathway
TypeCollection... the cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein...mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many...ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis...survival and proliferation. mTOR Pathway Plasmids Click on a name to find available plasmids for the gene...Sabatini . Return to top mTOR Pathway - Gene List Click on a name to find available plasmids for the gene... -
CRISPR Plasmids - Plants
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled... ID Plasmid Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
Synthetic Biology - Metabolism
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Synthetic Biology plasmids for metabolic enzymes and pathways. Plasmid...collection of synthetic biology plasmids related to metabolic pathways and components. Examples Include: Biofuels... Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top Do you have suggestions for other... -
Plasmids for Stem Cell Research
TypeCollection...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication Return to ...Marker PI Publication Return to top C. elegans ID Plasmid Gene/Insert Promoter PI Publication Return to...Drosophila ID Plasmid Gene/Insert Promoter PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources Addgene has a ... -
All Antibodies
TypeCollection...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...Source Species Isotype Reactivity Recommended Applications PI Return to Top Do you have suggestions for... -
CRISPR Plasmids - gRNAs
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your ...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
CRISPR Plasmids - Base Edit
TypeCollection...and are thus well suited to directed evolution applications. Examples of these base editing systems include...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI...PI Publication Return to top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication... -
Validated gRNA Sequences
TypeCollection...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...