Skip to main content
Addgene

We narrowed to 1,029 results for: ELL

Showing: 161 - 200 of 1029 results
  1. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... time and are potentially heritable in dividing cells. CRISPR Activate and Interfere technologies also...
  2. Plan Your Experiment

    Type
    Guide
    ...difficult-to-transfect cells. You can direct expression to specific cell types by using cell-specific promoters...human embryonic kidney 293 (HEK293) cells. For more difficult cell types, you may need to look into other...are good choices for more difficult cell types like primary cells. For CRISPR delivery, lentiviral and...deliver to target cells through microinjection or electroporation. The target cells translate the mRNA...complexes directly into your target cells. In this case, your target cells are not transcribing DNA to mRNA...possible genotypes within the resulting cell population. Some cells may remain wild type due to either (1...modifications . Cell Population The first step of validation is determining the type of cell population you...
  3. Adenovirus Guide

    Type
    Guide
    ...enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation....expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line. There is a rare...transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy... construct flanked by ITRs. Cells from the packaging HEK293 or HER911 cell lines expressing E1 are transfected...HER911 cells throughout viral vector production. During experiments, GFP can be used to sort cells infected...transfected into HER911 E4+ cells for rAdV vector production, as HEK293 cells do not contain E4. Download...immune cells and antibody production that develops after exposure to an antigen. AdEasier-1 cells BJ5183...
  4. All Antibodies

    Type
    Collection
    ...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this page you...
  5. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...is highly recommended that you determine if your cell type contains the target sequence before using any...
  6. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3 belongs to the...
  7. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...enhancers in the retina alters photoreceptor and bipolar cell fate specification, yet differs from deleting both...
  8. Molecular Biology Reference

    Type
    Guide
    ...daughter cells. These daughter cells contain the same genetic information as the parental cell, and are...with the host cell. Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and...chemistry enable isolation and purification of cellular components, such as DNA, but practically this ...and each daughter cell receives at least one copy of the plasmid. By the 1970s the combined discoveries...are thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and... and ideally would replicate these plasmids upon cell division in addition to their own genomic DNA. Because...additional replication burden, the rate of bacterial cell division is reduced (i.e., it takes more time to...
  9. Resolute Plasmid Collection

    Type
    Collection
    ...the global benefit of basic academic research as well as applied research in small biotech and pharmaceutical...
  10. Chemogenetics Guide

    Type
    Guide
    ...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 28:112-126...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, therefore allowing precise control over the cell population they are targeted to. To find chemogenetics...coupled receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ...
  11. Guide to Using Pooled Libraries

    Type
    Guide
    ...200x the number of cells as plasmids in the TKO library. Using large numbers of cells minimizes the effects...selection Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence ...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll infect two sets of cells and subject... effects of expressing multiple genes at once. A well-designed screen can help you begin to understand...libraries, plasmid DNA can be delivered directly to the cells of interest. With others, notably pooled lentiviral...subsequently used to deliver the plasmids to the cells of interest. In either case, next-generation sequencing...
  12. Optogenetics Guide

    Type
    Guide
    ...wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics...hyperpolarization (inhibition) of the cell when triggered with yellow light, thus inhibiting function of ...that hyperpolarizes (inhibits) the cell when triggered by green-yellow light. Arch Variants. Arch variants...subpopulation of cells within the injection site of the viral vector, rather than in all cells. For example...2010 Molecular and cellular approaches for diversifying and extending optogenetics. Cell. 196:1-28. PMID ...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Example ...
  13. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...and the resulting heteroduplex is resolved by the cell’s mismatch repair (MMR) system. Alternatively, if...
  14. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ... adenovirus expressing a variety of reporters as well as the Cre and Flp recombinases. Genes can be cloned...
  15. Arf GTPase Family

    Type
    Collection
    ...concepts and challenges. Molecular Biology of the Cell , 30 (11), 1249–1271. PMID: 31084567 (Link opens...
  16. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...
  17. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  18. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
  19. Colony Formation Titering Assay

    Type
    Protocol
    ...1,000 cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into...polybrene. Mix well by pipetting or inverting. Aliquot 1.35 mL of the cell suspension into each well of the 6... of selection, no cells have survived in the untransduced well, while lawns of cells are present in the...protocol was developed for A549 cells but can be adapted to a variety of target cell lines and selection markers...the cells cannot be used for later experiments. Workflow Timeline Day 0: Seed and transduce cells Day ...health of the target cell line is critical for obtaining accurate titers. Check the cells for mycoplasma (...regularly Do not over or under-grow your cells. Thaw a new vial of cells after 20–30 passages. Do not add penicillin...
  20. Lentivirus ddPCR Titration

    Type
    Protocol
    ... viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add 150...1: Seed and transduce cells Day 4: Treat cells with Benzonase and harvest cells Day 4+: ddPCR and analysis...below). Seed 300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus... for 10 wells with 3,000,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well is ...the 6-well plates. Be sure to use a new aspirating pipette for each well as to not contaminate cell conditions...pipette for each well. Detach cells by incubating with 200 µL TrypLE for 1–2 min. Resuspend cells in 500 µL ...
  21. Fluorescence Titering Assay

    Type
    Protocol
    ...Procedure Seed 75,000 cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute ...,000 cells into 14 mL of DMEM complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension...suspension into each well of the 6-well dish. Incubate the cells overnight. If using freshly collected virus...dilutions well Gently aspirate media from the cells. Add 1.5 mL of a viral dilution to each well (each well... well gets one dilution with one well remaining as the untransduced control). Count the cells in the remaining...fluorescent-positive cells in each well. When calculating titer, only consider wells with less than 40% ...: If 150,000 cells were transduced in the 1:100 well, resulting in 25% fluorescent cells, then the titer...
  22. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...transfected cells. k. Incubate cells at 37°C, 5% CO 2 for 24 hours. Day 4: l. Harvest media from cells and transfer... infect the target cells. Addition of puromycin will allow you to select for cells that stably express... 7×105 HEK-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37°C, 5% CO 2...Although cells should regularly be passaged in DMEM + 10% FBS with penicillin/streptomycin, cells should... temperature. g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM...you do not want to dislodge the cells from the plate. i. Incubate cells at 37°C, 5% CO 2 for 12-15 hours...antibiotics to the cells and incubate at 37°C, 5% CO 2 for 24 hours. Day 5: n. Harvest media from cells and pool...
  23. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest antibody Equipment...10 µL of the cell suspension/trypan blue mix into a cell counting chamber. Load the cell counting chamber...HEK293 cells and media to 50 mL conical tubes. Centrifuge for 15 min at 3100 x g to pellet the cells. Filter...interest in cell culture. This protocol describes how to transfect suspension HEK293 cells with recombinant...Section 1: Seeding cells The day prior to transfecting, seed a 108 mL culture of HEK293 cells at a density ...Pro-Tip Do not use cells that are over 30 passages. Section 2: Transfection Check the cell density and viability...transfer 0.5 mL of HEK293 cell suspension into a clean microcentrifuge tube. Pro-Tip Cells settle quickly and...
  24. Kit Free RNA Extraction

    Type
    Protocol
    ... the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the pellet get too... or cells without a kit. The general steps of this protocol include homogenization/lysis of cells or tissues...lyse tissues or cells in Solution D. For tissues: use 1 mL of Solution D per 100 mg of cells. For cultured...cultured cells: use 1 mL of Solution D per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5...effectively lyse open the cells. Extract RNA from the homogenized sample(s).Transfer tissue/cell lysate to a 4 mL...gel-like white pellet of total RNA in the bottom of the tube. Wash the RNA by resuspending the pellet in 0.5–...
  25. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...first three wells of each row, using a different standard solution for each row of a 96-well ELISA microplate...remove the plate seal from the 96-well plate and set aside. Aspirate the wells and use a multichannel pipette...Solution directly to the wells to stop the reaction. Measure the absorbance of each well at 450 nm on the spectrophotometer...options available. Caution Use the Stop Solution in a well ventilated area and avoid breathing in the vapors...
  26. Immunocytochemistry

    Type
    Protocol
    ... Seeding cells Place a sterile poly-D-lysine coated coverslip in each well of a 24-well cell culture treated...treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to grow to the desired density before... permeabilizing cells Gently aspirate the media from the 24-well plate. Wash each well with 500 µL of ...detect antigens in cells. Here we describe the basic steps for fixing and labeling cells in culture with ...2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment Pipette controller Pipette...Sterile Poly-D-lysine coated coverslips HeLa cells 24-well plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino... the microscope slide with the cell side facing down. Observe the cell labeling on a microscope with appropriate...
  27. Lentivirus Production

    Type
    Protocol
    ...such as stable-cell line generation. Workflow Timeline Day 0: Seed 293T packaging cells Day 1 (pm): Transfect...and for each cell line. Considerations Before You Start The health of the packaging cell line is critical... viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a T75 flask in ...: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Friday: Plate 8×10 5 cells in a T75 flask .... Use cells that are below passage 15 for viral production. Procedure Seed 293T packaging cells at 3.8....8×10 6 cells per plate in DMEM Complete in 10 cm tissue culture plates. Incubate the cells at 37 °C, ...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1-2 days after...
  28. General Transfection

    Type
    Protocol
    ... of HEK293T cells optimized for viral production (AAVpro or Lenti-X), but any HEK293T cell line should...different cell lines and different transfection reagents. Workflow Timeline Day 0: Seed HEK293T cells (or a... health of the cell line is critical for obtaining high levels of virus. HEK293T cells should be split...Plate 1x10 6 cells in a 75 cm 2 flask in a volume of 15 mL. Wednesday: Plate 1x10 6 cells in a T75 flask...8x10 5 cells in a T75 flask in a volume of 15 mL. Do not add antibiotics to the media. Use cells that are...PEI determined. Procedure Seed HEK293T cells at 3.8x10 6 cells per plate in DMEM complete in 10 cm tissue...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1–2 days after...
  29. CRISPR Library Amplification

    Type
    Protocol
    ... minutes) to pellet bacteria. Decant LB and weigh pellet. The total weight of each pellet should be ~1...limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 hours) Cells should be harvested first...electrocompetent cells (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other...Maxipreps rely on incremental, ordered cell lysis. E. coli cells are subject to lysis by freeze-thaw if...Ensure that electrocompetent cells are being used. Chemically competent cells will not provide adequate ...CRISPR pooled plasmid libraries in Escherichia coli cells. Protocols...of a pooled-plasmid library in Escherichia coli cells. Pooled libraries contain tens to millions of different...
  30. Protocol - Bacterial Transformation

    Type
    Protocol
    ...commonly referred to as 'competent cells.' Many companies sell competent cells, which come frozen and are prepared...that came with your competent cells. Pro-Tips Commercial competent cells range significantly in their ...SOC media Competent cells DNA you'd like to transform Procedure Take competent cells out of -80°C and thaw...use electro-competent cells. Instead of relying on the heat-shock to cause the cells to take up the DNA,...process by which foreign DNA is introduced into a cell. Transformation of bacteria with plasmids is important... all plasmids (even those designed for mammalian cell expression) carry both a bacterial origin of replication...transformation efficiency. The lowest efficiency cells (usually the least expensive) are fine for transforming...
  31. Western Blot

    Type
    Protocol
    ...a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at 100 x g . Gently remove...remove supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube. Centrifuge... g . Carefully remove supernatant. Resuspend cell pellet in appropriate volume of cold lysis buffer. Pro-Tips...buffer will vary depending on the size of your cell pellet but will generally be between 250–1000 µL . The...This protocol describes the basic steps for lysing cells, determining total protein concentration in the ...use western blotting to visualize a protein from cells or tissue samples. Equipment Microcentrifuge 0.5...
  32. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ... Wash the pellet or column with 70% ethanol to remove excess salt. Resuspend the DNA pellet, or elute ...careful not to disturb the bacterial pellet. Resuspend the pellet in 100 μL of cold Solution I. Vortex... tube for 5 min at 12,000 g. Notes: Pellet contains proteins, cell fragments, salt and other extra particles...Optional Wash the pellet with 70% ethanol. Note: This step removes excess salt from the pellet which can cause...the sink. Pro-Tip Be careful, the pellet is harder to see and less well attached to the tube after the 70%...Invitrogen , and (Link opens in a new window) Promega sell kits for isolating plasmid DNA in quantities as ...require larger cultures). Centrifuge the culture to pellet the bacteria before proceeding with DNA preparation...
  33. AAV ddPCR Titration

    Type
    Protocol
    ...Axygen, PCR-02-FCP-C ddPCR 96-well PCR plates, Bio-Rad, 12001925 48-well dilution plate, Bio-Rad, MLL4801...the 96-well plate sealer by gently touching the screen. Prepare the Serial Dilution Place a 48-well dilution...10 sec before use. Place an 8-well PCR tube strip into a chilled 96-well freezer block. Add 20 µL of the...touch the bottom of the well. Lift the tips ~1 mm. Touch the side of the well and tilt the pipette tips...Centrifuge, Thermo Scientific, 10199-452 Ice bucket 96-well freezer blocks (x 3) Reagents Molecular Biology ...dilution plate in a chilled 96-well freezer block and place in the dilution BSC. Prepare 1X dilution buffer... µL of each viral sample to Dilution 1 in the 48-well dilution plate and pipette 5–10 times to mix. Dilute...
  34. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...above the well. Very slowly and steadily, push the sample out and watch as the sample fills the well. After...perform gel electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave...the gel. Pour the agarose into a gel tray with the well comb in place. Pro-Tip Pour slowly to avoid bubbles...the gel. Any bubbles can be pushed away from the well comb or towards the sides/edges of the gel with ...loading buffer to each of your DNA samples and mix well. Use 5 µl of loading buffer per 25 µl of sample....sample causing it settle to the bottom of the gel well, instead of diffusing in the buffer. Once solidified...added EtBr to your gel, add some to the buffer as well. EtBr is positively charged and will run the opposite...
  35. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...Generating Stable Cell Lines with Lentivirus Genomically integrate your DNA sequence into a cell line Isolating...Isolating a Monoclonal Cell Population by Limiting Dilution Generate monoclonal cell lines from a polyclonal...polyclonal pool of stable cells AAV Production in HEK293 Cells Produce adeno-associated virus to deliver your...Extraction Without a Kit Extract RNA from tissues or cells without a commercial kit Plasmid Cloning Name Description...Transfection Introduce plasmid DNA to mammalian cells Lentivirus Production Produce lentivirus with a ... virus from a preparation produced in mammalian cells Watch the Video! AAV Titration by qPCR Using SYBR...Transfection Introduce plasmid DNA to mammalian cells to produce antibodies Antibody Purification Purify...
  36. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...non-PCR–related fluorescence fluctuations and to minimize well-to-well variability that result from a variety of causes...mix into the wells. Reagent Amount for ONE Reaction Amount for 100 reactions (1 x 96 well plate) Universal...mix + water ). Add 15 μL of Master Mix per well and mix well by pipetting back and forth at least 5 times...by these institutions. This protocol is for a 96-well plate with 20 μL reaction volume. Last Update: February...buffer Nuclease-free water Microcentrifuge tubes 96-well optical plate Pipette tips General Considerations...pipetting error and variability Mix samples very well by pipetting back and forth multiple times at each...half of the final volume (mix with >50 uL if your well contains 100 uL) Use a multichannel pipette to load...
Showing: 161 - 200 of 1029 results