We narrowed to 210 results for: cycs
-
TypeCollection...Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible Expression page Bacteria Lac...
-
CRISPR Pooled gRNA Libraries
TypeCollection...Enriched subpools (kinase, nuclear, ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini and Lander... -
AAV ddPCR Titration
TypeProtocol...sealed, proceed to thermocycling. Thermal Cycling Run the following PCR parameters. Cycling Step Temperature...Droplet Digital PCR System, Bio-Rad, DX200 Thermal Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1...Temperature (°C) Time (min) Ramp Rate (°C/sec) # Cycles Denaturation 95 10 2 1 Denaturation 95 0.5 2 50 Annealing... -
Lentivirus ddPCR Titration
TypeProtocol...sealed, proceed to thermocycling. Thermal Cycling Run the following PCR parameters: Cycling Step Temperature...Droplet digital PCR System, Bio-Rad, DX200 Thermal Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1...Temperature (°C) Time (min) Ramp Rate (°C/sec) # Cycles Enzyme Activation 95 10 2 1 Denaturation 94 0.5 2 40 ... -
What is Polymerase Chain Reaction (PCR)
TypeProtocol... heating and cooling (denaturing and annealing) cycle. The process became automated with the discovery...polymerase can withstand many heating and cooling cycles, which would denature DNA polymerases from other...a few nanograms of template DNA through several cycles of denaturation, annealing, and synthesis. After... 2 minutes at 72°C. Repeat steps 8-10 for 25-30 cycles. Final Extension for 5 minutes at 72°C. Run 2 μL... -
Kit Free RNA Extraction
TypeProtocol...avoid multiple freeze-thaw cycles. Pro-Tip To avoid multiple freeze-thaw cycles of your entire RNA sample... -
Genetic Code Expansion
TypeCollection...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries ... -
Antibody Guide
TypeCollection...least 10 µL. Antibodies cannot tolerate freeze-thaw cycles. Here are a few tips for storing your antibody:... -
Fluorescence Titering Assay
TypeProtocol...lentiviral supernatants to multiple freeze-thaw cycles. Procedure Seed 75,000 cells into each well of ...and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing and aliquoting... -
Colony Formation Titering Assay
TypeProtocol...supernatants be subjected to multiple freeze-thaw cycles. This protocol outlines the seeding of the cells...and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing and aliquoting... -
Pouring LB Agar Plates
TypeProtocol.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated...from the autoclave. Pro-Tip Once your autoclave cycle is complete, we recommend opening the door to the... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...or -80°C for long-term storage. TIP: Freeze/thaw cycles decrease the efficiency of the virus, so Addgene...into smaller tubes to prevent multiple freeze/thaw cycles. Back to Top F. Infecting Target Cells Lentiviral... -
Protocol - How to Create a Bacterial Glycerol Stock
TypeProtocol...it is kept at -80°C. Subsequent freeze and thaw cycles reduce shelf life. To recover bacteria from your... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol... mixed oligos in a PCR tube. Place tube in a thermocycler programmed to start at 95°C for 2 minutes. Then... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol...mL Kanamycin 50 µg/mL Spectinomycin 50 µg/mL Tetracycline 10 µg/mL Tips and FAQ What is the difference... -
Ligation Independent Cloning
TypeProtocol...product is then repaired during the replication cycle. Empty vectors for LIC typically employ type II ... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol...buffer contains ATP, which degrades upon freeze/thaw cycles, it is a good idea to take a fresh tube, thaw it... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...supernatants be subjected to multiple freeze-thaw cycles. Procedure Before beginning, determine the optimal... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol... signal that is most evident during initial PCR cycles. This background signal must be removed to accurately... -
Sequencing Primers
TypeGuide...Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer... primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA... -
Adeno-associated virus (AAV) Guide
TypeGuide...replicate in the host cell and complete the lytic cycle. AAVs are therefore non-pathogenic and generally... viruses, wild-type AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating...actively causing symptoms or replicating. Lytic cycle Viral replication process where the virus uses the... -
Gamma-Retroviral Vector Guide
TypeGuide...genomes into hosts in order to continue their lifecycle and replicate. This feature can be harnessed for...Gamma-retroviral Packaging Systems The Retroviral Lifecycle Types of Viruses Viral Vector Elements More Viral... -
Lentiviral Vector Guide
TypeGuide...genomes into hosts in order to continue their lifecycle and replicate. This feature can be harnessed for...Lentiviral Plasmid FAQs Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral ... -
CRISPR Guide
TypeGuide...efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during the S and G2 ... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries ... -
Promoters
TypeGuide...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human... -
Chemogenetics Guide
TypeGuide...inhibit neuronal signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently... -
Optogenetics Guide
TypeGuide...nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation... -
Molecular Biology Reference
TypeGuide.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be... -
Antibody Guide
TypeGuide...least 10 µL. Antibodies cannot tolerate freeze-thaw cycles. Here are a few tips for storing your antibody:...