We narrowed to 18,261 results for: grn
-
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73178-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiGuide-Puro (#73178). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome.DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (Lentiviral Prep)
Viral Prep#92379-LVPurposeReady-to-use Lentiviral Prep particles produced from Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (#92379). In addition to the viral particles, you will also receive purified Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Concentrated lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .DepositorAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)
Plasmid#60224PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and three U6-driven sgRNAs targeting Kras, p53, and Lkb1. Contains KrasG12D HDR donor. AAV backbone.DepositorInsertsUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS, No promoter, and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1
Plasmid#49772PurposeLevel 2 constructDepositorInsertsgRNA_PDS2-Cas9-sgRNA_PDS1
UseCRISPRExpressionPlantAvailable SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA
Plasmid#47108PurposeExpresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertSPgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
gRNA_GFP-T1
Plasmid#41819PurposeExpresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineeringDepositorInsertgRNA_GFP-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T2
Plasmid#41818PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T2 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T2
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRPR1_gRNA_handle_RPR1t
Plasmid#49014PurposegRNA expression empty vector (yeast)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastPromoterpRPR1Available SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6>sgRNA(F+E)
Plasmid#59986PurposeEmpty vector for sgRNA cloning (F+E modified backbone)DepositorTypeEmpty backboneUseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only