We narrowed to 615 results for: vp64
-
Plasmid#171758PurposeLentiviral vector for constitutive expression of fusion protein WP1-CRY2PHR-VP64DepositorInsertWP1-CRY2PHR-VP64
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-dSpCas9-HF1-VP64-6xHis
Plasmid#92118PurposeExpression of dead/inactive increased fidelity SpCas9-HF1-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive SpCas9-HF1-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJC-elav1.8kb-TALE1-VP64-P10
Plasmid#104609PurposeExpresses TALE1 under the control of a 1.8kb elav enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-mhc2.4kb-TALE3-VP64-P10
Plasmid#104611PurposeExpresses TALE3 under the control of a 2.4kb mhc enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-ase0.8kb-TALE3-VP64-P10
Plasmid#104610PurposeExpresses TALE3 under the control of a 0.8kb ase enhancer elementDepositorAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-20xUAS-TALE1-VP64-P10
Plasmid#104606PurposeExpresses TALE1 under UAS controlDepositorInsertTALE1
UseTALENExpressionInsectPromoterhsp70Available SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4872 VP64-intN in PolyTX-mNeonGreen
Plasmid#244191PurposeConstitutive expression of VP64-intN split synTF componentDepositorInsertSplit synTF component VP64-intN
UseSynthetic BiologyTags3xFLAG - nuclear localization sequenceExpressionMammalianPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PMP34-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170997PurposeHiLITR transcription factor with full-length PMP34 targeting sequence (Peroxisome)DepositorInsertPMP34(FL)-NNES-hLOV-TEVcs(ENLYFQ-M)-GAL4bd-VP64-V5 (SLC25A17 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-MCS-VP64_C-term
Plasmid#136887PurposeDoxycycline-inducible vector backbone containing a multiple cloning site (MCS), the VP64 activator domain and a STOP codonDepositorInsertVP64 activator domain
UseLentiviralTagsNoneExpressionMammalianAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJC-20xUAS-TALE-VP64-P10
Plasmid#104605PurposeControl plasmid (no TALE array) with P10 terminatorDepositorTypeEmpty backboneUseTALENExpressionInsectPromoterhsp70Available SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-VP64-IRES-zsGreen1
Plasmid#138461Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-VP64DepositorInsertMCP-VP64-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LV-TRE-VP64 human MyoD-T2A-dsRedExpress2
Plasmid#60629PurposeExpresses VP64 human MyoD and dsRedExpress2 in response to doxycyclineDepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LV-TRE-VP64 mouse MyoD-T2A-dsRedExpress2
Plasmid#60625PurposeExpresses VP64 mouse MyoD and dsRedExpress2 in response to doxycyclineDepositorInsertVP64 mouse MyoD
UseLentiviralPromoterTREAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_4D5-High-CAR-mCherry_PGK_4D5-Low-SynNotch_Gal4VP64_RHL133
Plasmid#164822PurposeLentiviral vector for Gal4 inducible AntiHER2 4D5-High CAR-mCherry and constitutive expression of antiHER2 4D5-Low Gal4VP64 Synthetic NotchDepositorInsertsAntiHER2 4D5-High Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
AntiHER2 4D5-Low Gal4VP64 synthetic Notch receptor
UseLentiviralTagsmCherryPromoterminiCMV and pGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only