169,450 results
-
Plasmid#106174PurposeTight affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1 and AAV9InsertSF-iGluSnFR.A184S
UseAAVMutationGltI: A184SPromoterhSynapsinAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-V5-ccdB
Plasmid#87064PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneTags3xFLAG-V5ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
L_NLS 41kDa
Plasmid#201342PurposeNucleocytoplasmic transport probeDepositorInsert(NLS)SV40A4-EGFP-2PrA
ExpressionMammalianAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG_PCP-T5Exo
Plasmid#214736Purposeencodes T5 exonuclease with a PP7 coat protein fused to the N terminusDepositorInsertCAG_PCP-T5Exo_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHTN_HaloTag_KIF5B
Plasmid#213404PurposeFull-length human kinesin-1 with HaloTag at the N-terminusDepositorAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-taCasp3-TEVp (AAV8)
Viral Prep#45580-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-flex-taCasp3-TEVp (#45580). In addition to the viral particles, you will also receive purified pAAV-flex-taCasp3-TEVp plasmid DNA. EF1a-driven, Cre-dependent, bicicstronic expression of designer pro-taCasp3 and TEVp. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB819-PKR-hum
Plasmid#20030DepositorInsertProtein kinase R (EIF2AK2 Human)
ExpressionYeastAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 FLAG-RAB35 Q67L
Plasmid#107105PurposeLentiviral vector that codes for FLAG-RAB35 Q67L (human) protein. Puromycin resistance for mammalian selection and ampicillin resistance for growth in Stbl3 cells.DepositorInsertRAB35 (RAB35 Human)
UseLentiviralTagsFLAG tagExpressionMammalianMutationQ67LPromoterCMVAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
N1-Tq-Ca-FLITS
Plasmid#191454PurposeGenetically encoded calcium sensor (GECI) Tq-Ca-FLITS that reports with lifetime and intensity changesDepositorInsertTq-Ca-FLITS
ExpressionMammalianAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP
Plasmid#50469PurposeEGFP under the control of CaMKIIa promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterCaMKIIaAvailable SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-TNKS-2
Plasmid#34691DepositorAvailable SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV2)
Viral Prep#50457-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNP2389 [pNP2314 - ISCro4 Donor + ISCro4 Target-RTG-Matched]
Plasmid#247251PurposeMeasure ISCro4 activity via luciferase expressionDepositorInsertpNP2314 - ISCro4_Donor, ISCro4_Target_RTG-Matched
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-hOCT4
Plasmid#20726DepositorAvailable SinceMarch 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G (AAV1)
Viral Prep#52473-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJG100
Plasmid#138966PurposePeft-3::wrmScarlet1-10::unc-54 3’UTR. Expresses wrmScarlet1-10 in somatic tissues of C. elegansDepositorInsertwrmScarlet1-10
ExpressionWormAvailable SinceJuly 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-MT2A
Plasmid#11613DepositorAvailable SinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.cTNT.PI.eGFP.WPRE.rBG
Plasmid#105543PurposeAAV expression of EGFP from cTNT promoterDepositorHas ServiceAAV9InsertcTNT-PI-EGFP
UseAAVExpressionMammalianPromotercTNTAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Ash2L full
Plasmid#15548DepositorInsertAsh2L (ASH2L Human)
ExpressionMammalianMutationR622H (Please see depositor comments below)Available SinceAug. 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ phiC31 integrase
Plasmid#216237PurposeFor the overexpression of phiC31 integraseDepositorInsertintegrase from phage φC31
UseSynthetic BiologyExpressionMammalianPromoterCMV IE94Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_Ptgs2
Plasmid#209519PurposeExpresses luciferase under control of Ptgs2 promoter in transfected cellsDepositorInsertPtgs2 (Ptgs2 Mouse)
UseLuciferaseAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac His6 TEV LIC cloning vector (4B)
Plasmid#30115DepositorTypeEmpty backboneTagsHis6-TEVExpressionInsectAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV_AncBE4max_P2A_GFP
Plasmid#112100PurposeC:G-to-T:A base editingDepositorInsertAncBE4max_P2A_GFP
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV6 trial size)
Viral Prep#37825-AAV6.TPurposeReady-to-use AAV6 trial size particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-tdTomatof
Plasmid#104060PurposeAlso known as hSyn1-tdTomato-f. AAV expression of Farnylsated tdtomato for tracingDepositorInserttdTomato
UseAAVPromoterhSynAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPLICS LY-MT Long P2A
Plasmid#213613PurposeDetect the long-range Lysosome-Mitochondria contactDepositorInsertSPLICS LY-MT Long P2A
ExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTS118 His14-Avi-28xGS-anti ALFA tag nanobody
Plasmid#199371PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-ALFA nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ETF1-E55D
Plasmid#130876PurposeEncodes ETF1 with an E55D substitutionDepositorInsertEukaryotic transcritional termination factor ETF1-E55D (ETF1 Human)
ExpressionMammalianMutationE55DPromoterCAGAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
mtsCOXVIIIx2-B-gTEMP/pcDNA3
Plasmid#199806PurposeFluorescent temperature indicator B-gTEMP fused with mitochondrial targeting sequenceDepositorInsertB-gTEMP
TagsmtsCOXVIIIx2ExpressionMammalianAvailable SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry2-C1
Plasmid#54563PurposeLocalization: C1 Cloning Vector, Excitation: 587, Emission: 610DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsmCherry2ExpressionMammalianAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-attP
Plasmid#51019PurposeVector for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Contains the visible marker 3xP3-DsRed. As known as pHD-DsRed-attPDepositorInsertsattP
LoxP-3xP3-DsRed-LoxP
UseHigh copy, amp resistancePromoter3xP3 and NoneAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET29b-H6_Streptavidin_sfGFP
Plasmid#124296PurposeHis6-tagged Streptavidin GFP fusion proteinDepositorInsertHis6 tag - TEV protease site - T7 tag - Streptavidin (15-159) - superfolder GFP
TagsHis6 and T7 tagsExpressionBacterialAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SynB
Plasmid#174861PurposeExpresses mouse syncytin B in mammalian cellsDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
psigma2-EGFP
Plasmid#53610PurposeExpresses sigma2 of adaptor protein of AP2DepositorAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pZA31-sulA-GFP
Plasmid#78493PurposeExpression of GFP under the sulA promoter.DepositorInsertGFPmut2
ExpressionBacterialAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (AAV Retrograde)
Viral Prep#100854-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Hygro-CMV-FUCCIplex
Plasmid#240221PurposeMultiplexable FUCCI sensor (FUCCIplex). The CMV promoter drives the expression of the fluorescent sensor.DepositorInsertFUCCIplex
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pE-FLP
Plasmid#45978PurposeExpresses yeast Flp driven by the constitutive promoter pE from phage P2DepositorInsertflp
UseSynthetic BiologyExpressionBacterialMutationflp driven by the constitutive promoter pE from p…PromoterpE (from phage P2)Available SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (AAV5)
Viral Prep#162379-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (#162379). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8f-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of the ultrafast calcium sensor, GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_tBFP_PGK_mCitrine
Plasmid#188386PurposeLentiviral vector - tBFP reporter for Gal4-based SNIPRs with a constitutive mCitrine;DepositorInsertGal4UAS_tBFP_PGK_mCitrine
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0389
Plasmid#141600PurposeLentiviral vector for overexpressing the SMARCA4 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-RP
Plasmid#60497PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of RFP, rtTA and puromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-CDK12-V5-miniTurbo_IDG-K
Plasmid#135243PurposeGateway destination clone of CDK12 (human) tagged with C-terminal V5-miniTurbo for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertCDK12-V5-miniTurbo (CDK12 Human)
UseLentiviral; Gateway destinationTagsV5-miniTurboExpressionMammalianPromoterUbiquitinAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
CDK1as_T2A_puromycin
Plasmid#118595PurposeOne of three plasmids required to create CDK1as human cells by single transfection (One shot system). CDK1as cDNA and puromycin resistance cassette flanked by Sleeping Beauty transposon.DepositorInsertCDK1
ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TEVp
Plasmid#162599PurposeTEV protease under CMV promoterDepositorInsertTEV protease
ExpressionMammalianPromoterCMV promoterAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only