Purpose
Expresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
Insert
dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (
Actc1 Mouse, Synthetic)
Available Since
Sept. 12, 2018
Availability
Academic Institutions and Nonprofits only