We narrowed to 2,364 results for: 1186
-
Plasmid#1186DepositorAvailable SinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-mKate
Plasmid#208765PurposeTo express C2m2-mKate in bacteriaDepositorInsertC2m2-mKate (Mfge8 Mouse)
TagsmKateExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSYC-176
Plasmid#178961PurposeExpresses human GFAP fused to 3xFLAG tag in mammalian cellsDepositorInsertGlial fibrillary acidic protein (GFAP Human)
Tags3xFLAGExpressionMammalianPromoterCMV IE94 PromoterAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCXLE-hUL + mTAGBFP2
Plasmid#74944PurposeDosage control and tracing of reprogramming episomesDepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
HR-TERT-SV40-GFP
Plasmid#71397PurposeHomologues recombination donor plasmid fo the TERT promotor region introducing a SV-40 driven GFP marker in the TERT promotor. Includes 1kb of TERT coding region in right homologues arm.DepositorInsertTERT (TERT Human)
TagsSV-40 GFP insertion in TERT promotorPromoterEndogenous TERT promotorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/mito-mutant-hogg1
Plasmid#18708DepositorInsert8-oxoguanine DNA glycosylase (OGG1 Human)
ExpressionMammalianMutationAmino acid 229, Arginine to GlutamineAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pOst1-pro-alphaf(MUT1)-E2-Crimson
Plasmid#117662PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpOst1-pro-af(MUT1)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGV3319
Plasmid#170277PurposeExpression of mutant Bst polymerase (Bst-LF D720A) for loop mediated isothermal amplification (LAMP)DepositorInsertBst-LF D720A
TagsHexahistidineExpressionBacterialMutationD720APromoterT7-lacAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSHUT4-eYFP
Plasmid#133094PurposeAgrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHIDepositorInsertenhanced yellow flourescent protein
UseFungal expressionPromoterTEF-1αAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/Nuc-mutant-hogg1
Plasmid#18710DepositorInsert8-oxoguanine DNA glycosylase (OGG1 Human)
ExpressionMammalianMutationAmino Acid 229 Arginine changed to GlutamineAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 CA
Plasmid#133264PurposeConstitutively-active (CA) mutant of OsRac1; Acts as a positive control for small GTPases activation assays.DepositorInsertOsRac1(G19V) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 G19VPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 DN
Plasmid#133263PurposeDominant-negative (DN) mutant of OsRac1; Acts as a negative control for small GTPases activation assaysDepositorInsertOsRac1(T24N) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 T24NPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/ER-αT2ib
Plasmid#110769PurposeExpresses ER intrabody against mouse and human TLR2DepositorInsertintrabody against mouse and human TLR2
TagsER retention signal (SEKDEL), ER signal peptide, …ExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-dSpCas9-HF1-VP64-6xHis
Plasmid#92118PurposeExpression of dead/inactive increased fidelity SpCas9-HF1-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive SpCas9-HF1-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMVTNT-EPHX1
Plasmid#53114PurposeIn vitro translation of microsomal epoxide hydrolaseDepositorAvailable SinceMay 7, 2014AvailabilityAcademic Institutions and Nonprofits only