We narrowed to 15,952 results for: grna
-
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SUPERBLADE5
Plasmid#134913PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-3XGFPnls
Plasmid#75385PurposePCP-3XGFPnlsDepositorInsertPCP
UseLentiviralTags3XsfGFPExpressionMammalianPromoterEFSAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-MCP-3XBFPnls
Plasmid#75384PurposeMCP-3XBFPnlsDepositorInsertMCP
UseLentiviralTags3XBFPExpressionMammalianPromoterEFSAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVSV-G
Plasmid#138479PurposeExpresses VSV-G envelope protein for pseudotyping NanoMEDIC particle.DepositorInsertVSV-G envelop protein
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRCherry2.1
Plasmid#108099PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBx-Spas-sgRNA-Kan
Plasmid#105233PurposePlasmid containing S. pasteurianus sgRNA with no 20bp target (Empty control) Kanamycin marker for P. putida and P. fluorescensDepositorInsertS. pasteurianus sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-lib 2.0
Plasmid#89638PurposesgRNA expression in mammalian cells after Gateway cloningDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_hygro-tagBFP-lox2272
Plasmid#162078Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m/LacZ
Plasmid#66192Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
KB701: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121818PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only