We narrowed to 4,404 results for: chm
-
Plasmid#135146PurposeRecombinant expression of CNOT4 with dual-affinity tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only
-
TOB1
Plasmid#156089PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CPSF4L
Plasmid#155479PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
SFRS17A-1
Plasmid#156011PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLRG1
Plasmid#155827PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBC2T-Ypet-FtnA
Plasmid#108969Purposeexpresses BC2-tag-Ypet-FtnA in mammalian cellsDepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(2Q)
Plasmid#21752DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains 2Q (2 glutamines) and there isno …PromoterCMVAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-VIM-BC2T
Plasmid#108966Purposeexpresses mCherry-vimentin-BC2-tag in mammalian cellsDepositorAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
DNMT1 KO Neo
Plasmid#16649DepositorInsertDNMT1 knock-out construct (DNMT1 Human)
ExpressionBacterialAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLAG mTOR 1968-2549 S2035T
Plasmid#23000DepositorAvailable SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
BOLL_RRM_pGEX
Plasmid#135130PurposeRecombinant expression of BOLL with dual-affinity tagDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-neo-C11orf51-3xFlag (2765)
Plasmid#39859DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMGF157
Plasmid#96972Purposeish1-mCherry insertion cassette with Hygro resistance geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + hygro…PromoterN/AAvailable SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-chCARex
Plasmid#87233Purposebacterial expression of GST-CAR extracellular domainDepositorAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAdEasy-EGFP-CLASP2 340-1362 9xS/A
Plasmid#24523DepositorInsertCLASP2 (340-1362) 9xS/A (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJuly 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75233PurposeCRISPR/Cas9 plasmid against human NFATc2DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMGF170
Plasmid#96997Purposeish1-mCherry insertion cassette with NAT resistance geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + NAT r…PromoterN/AAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-CSPG5 12959 (VL + VH) synNotch
Plasmid#247513PurposeExpresses a synNotch receptor binding to CSPG5DepositorInsertExpresses a synNotch receptor binding to CSPG5
UseLentiviralExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only