We narrowed to 39,931 results for: lat
-
Plasmid#15326DepositorInsertELL Associated Factor 2 (EAF2 Human)
UseBaculovirus constructionTagsFLAGExpressionMutationPromoterAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Control-E2F-3'UTR-Mut
Plasmid#21171DepositorInsertE2F 3'UTR Mutant (E2F1 Human)
UseLuciferaseTagsExpressionMammalianMutation2 miR binding sites mutated. Changed from GCACTTT…PromoterAvailable SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(E12,14K)-mPAGFP
Plasmid#168495PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertE12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-MCPIP1(150-453)
Plasmid#90109PurposeMammalian expression of Flag-MCPIP1(150-453)DepositorAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K83,88,104A
Plasmid#58405PurposeExpresses murine IFITM3-K83,88,104A with an N-terminal HA tag in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
UseTagsHAExpressionMammalianMutationLysines 83, 88, and 104 to AlaninePromoterCMV IEAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K83A
Plasmid#58401PurposeExpresses murine IFITM3-K83A with an N-terminal HA tag in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
UseTagsHAExpressionMammalianMutationLysine 83 to AlaninePromoterCMV IEAvailable SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K24A
Plasmid#58400PurposeExpresses murine IFITM3-K24A with an N-terminal HA tag in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
UseTagsHAExpressionMammalianMutationLysine 24 to AlaninePromoterCMV IEAvailable SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralTagsExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG5-Myr-FLAG-p110β-DM
Plasmid#55719Purposeeukaryotic expression of myristoylation tag (Myr-FLAG) p110b RBD double mutant S205D, K224ADepositorInsertp110 beta
UseTagsmyristoylation tag (Myr-FLAG)ExpressionMammalianMutationS205D, K224APromoterT7Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNMHCII-C1C2-GFP
Plasmid#46044DepositorInsertnonmuscle myosin heavy chain II-C, isoform C1C2 (Myh14 Mouse)
UseTagsGFPExpressionMammalianMutationPromoterCMV immediate earlyAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
psbA2(noATbox)-PHLS (c)
Plasmid#52308PurposeReplaces the psbA2 gene in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyTagsExpressionBacterialMutationCAAATACA box in the psbA2 promoter to ggcgcgccPromoterpsbA2Available SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYZ_NAND2_L17_S19_S11
Plasmid#132730PurposeT7 RNAP-driven expression of a 2-input NAND gate RNA with a GFP-ASV reporter that binds to 3WJ repressor trigger indices 19 and 11DepositorInsert3WJ_NAND2_L17_S19_S11
UseTagsExpressionBacterialMutationPromoterAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe-SIRT3
Plasmid#66167PurposeExpresses SIRT3 via retroviral methodDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 humanN-Flag SadBS
Plasmid#66881PurposeMammalian expression vector for expressing N-terminally Flag-tagged short isoform of SadBDepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMDC84-SEIPIN3-Ndelta
Plasmid#96981PurposeExpress N-terminal truncated Arabidopsis SEIPIN3 gene in plants.DepositorInsertSEIPIN3 (AT2G34380 Mustard Weed)
UseTags6xHis and GFPExpressionPlantMutationA segment of 507 nucleotides are deleted from the…Promoter35SAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
cpc-PHLS (g)
Plasmid#52311PurposeReplaces the cpc operon in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterSynechocystis endogenous cpc-operon promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH734-CEN-minHIS3
Plasmid#38227DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
UseTagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH737-CEN-maxHIS3
Plasmid#38229DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
UseTagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3 (=GPD)Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only