We narrowed to 547 results for: gcamp6s
-
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA
Plasmid#50943PurposeBicistronic vector expressing mRuby2 and GCaMP6f from a single open reading frame.DepositorInsertmRuby2-P2A-GCaMP6f
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA
Plasmid#51473PurposeBicistronic vector expressing mRuby2 and GCaMP6m from a single open reading frame.DepositorInsertmRuby2-P2A-GCaMP6m
UseAAVPromoterhSyn1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-H2B-PAmCherry
Plasmid#133419PurposeFluorescent reporter for calcium imaging and photoactivationDepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-GCaMP6F
Plasmid#137122PurposeIntersectional viral expression of GCaMP6F in cells expressing both Cre AND FlpDepositorHas ServiceAAV5 and AAV8InsertCon/Fon-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Con/Fon-GCaMP6M
Plasmid#137119PurposeIntersectional viral expression of GCaMP6M in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6F
Plasmid#137124PurposeIntersectional viral expression of GCaMP6F in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
15x-QUAS-dTomato-T2A-GCaMP6s
Plasmid#130666PurposeQUAS reporter line that expresses cytosolic dTomato and the GCaMP6s calcium indicator, separated by T2ADepositorInsert15xQUAS-dTomato-T2A-GCaMP6s
UseAe. aegypti expressionExpressionInsectPromoter15xQUAS-TATAAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-GCaMP6s-WPRE-pGHpA
Plasmid#67526Purpose"Fluorescent reporter for calcium imaging"DepositorInsertGCaMP6s
UseAAVTags6xHis, T7 tag, and Xpress epitopeExpressionMammalianPromoterEF1aAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-FLEx-axon-GCaMP6s
Plasmid#112010PurposeFor cre-dependent enriched expression of GCaMP6s in axonsDepositorHas ServiceAAV5 and AAV9Insertaxon-GCaMP6s
UseAAV and Cre/LoxTagsGAP43 palmitoylation domainExpressionMammalianPromoterhSynapsin1Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2
Plasmid#112006PurposeFor co-expression of GCaMP6s with mKate2DepositorHas ServiceAAV9InsertGCaMP6s-P2A-mKate2
UseAAVExpressionMammalianPromoterhSynapsin1Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6M
Plasmid#137121PurposeIntersectional viral expression of GCaMP6M in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3
Plasmid#112007PurposeFor co-expression of GCaMP6s with mRuby3DepositorHas ServiceAAV9InsertGCaMP6s-P2A-mRuby3
UseAAVExpressionMammalianPromoterhSynapsin1Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Synaptophysin-GCaMP6s
Plasmid#105715PurposeIn the presence of Cre, the plasmid can be used to express GCaMP6s fused to the presynaptic protein synaptophysin. Drives enriched expression of GCaMP6s in neuronal axon boutons.DepositorHas ServiceAAV5Insertsynaptophysin-GCaMP6s
UseAAV and Cre/LoxExpressionMammalianPromoterEf1a, Human elongation factor-1 alphaAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-GCaMP6f
Plasmid#73466PurposeExpresses GCaMP6f for calcium imagingDepositorInsertGCaMP6f
UseNeurotropic virusAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only