We narrowed to 2,551 results for: pcas9
-
Plasmid#232095PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTrex-b-NLS-hSpCas9
Plasmid#62543PurposeExpression of Cas9 in T. cruziDepositorInsertNLS-hSpCas9
UseCRISPR; Trypanosoma cruzi expressionTags3xFLAG and NLSPromoterRibo-HX1Available SinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta-mmr
Plasmid#169241PurposeCas9, beta, and mutL mutant expression plasmid for introducing chromosomal point mutationsDepositorInsertscas9
beta
mutL-E36K
UseCRISPR and Synthetic BiologyExpressionBacterialMutationChanged glutamic acid 36 to lysineAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–CgRNA
Plasmid#64955PurposeControl gRNA (GTCAAGGCACTCTTGCCTA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-C–dSpCas9
Plasmid#157836Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1397 DddAtox-C–dSpCas9–UGI–UGI–bpNLS
UseCRISPRAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-HIST1H4C
Plasmid#66944PurposeCRISPaint target selector HIST1H4CDepositorInsertgRNA HIST1H4C
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-BtW-eSpCas9
Plasmid#133358PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsFlag-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-a5 guide B
Plasmid#194011PurposeFor CRISPR knockout of integrin alpha5DepositorInsertsingle-guide RNA (a5_guide B)
UseCRISPRAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-aV guide A
Plasmid#194008PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide A)
UseCRISPRAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-aV guide B
Plasmid#194009PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide B)
UseCRISPRAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-a5 guide A
Plasmid#194010PurposeFor CRISPR knockout of integrin alpha5DepositorInsertsingle-guide RNA (a5_guide A)
UseCRISPRAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only