We narrowed to 5,311 results for: PID
-
Plasmid#172734PurposeExpression vector for SARS-CoV-2 (HexaPro-D614G) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseTags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
UseTagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainPromoterAvailable sinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-kappa-myc-dL5-2xG4S-TMst
Plasmid#73206PurposeExpresses myc-dL5(E52D)-TM (PDGFR derived) on the surface of mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-TM (MYC Human)
UseTagsThe FAP is fused with 2 copies of a G4S linker an…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m
Plasmid#113049Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1m in neuronsDepositorUseAAVTagsExpressionMutationPromoterhSynAvailable sinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorUseAAVTagsExpressionMutationPromoterhSynAvailable sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…TagsExpressionMammalianMutationPromoterCMV/Chick β-actin (CAG)Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorInsertLgBiT-hACE2-IgG1 Fc (ACE2 Human)
UseLuciferaseTagsIgG1ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P-Kv
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-Kv-WPRE
Plasmid#179465PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P-Kv
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIaAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRab18.N-Cas9-T2A-mCherry-P2A-Puro
Plasmid#129418PurposeEncoding Cas9 and sgRAB18.N for CRISPR/Cas9 mediated HDR tagging of endogenous human RAB18 N-terminusDepositorInsertSpCas9 and sgRAB18.N (RAB18 Human)
UseCRISPRTagsT2A-mCherry-P2A-PuroExpressionMammalianMutationPromoterhU6Available sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Synthetic, Human)
UseTagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-2P-WPRE
Plasmid#179469PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterGFAPAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
UseTagsminiTurboExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2P-Kv
Plasmid#179462PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2P-Kv
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-Caveolin1-CMV-GFP
Plasmid#83272PurposeAdenoviral expression of Caveolin1 with co-expression of GFPDepositorInsertsUseAdenoviralTagsExpressionMutationPromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-WPRE
Plasmid#179466PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIaAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastMutationPromoterAOX1Available sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_C12orf49-miniTurbo
Plasmid#155112Purposetransfection plasmid for the exogneous expression of C-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
UseTags3x Flag and miniTurboExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable sinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianMutationPromoterEFS and IRESAvailable sinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-INPP4B-mCherry
Plasmid#184055PurposeLysosome targeted inositol polyphosphate-4-phosphatase type II B; tagged with mCherry.DepositorUseTagsLysosome-associated membrane protein 1 (LAMP1). a…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fba_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107582PurposeB. megaterium DSM319 fba promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfba promoter Bacillus megaterium DSM319Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL
Plasmid#73209PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in endoplasmic reticulum of mammalian cells with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-mCer3-KDEL (MYC Synthetic, Human)
UseTagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM30-ARC105
Plasmid#133426PurposeHuman ARC105 coding sequence in vector for in vitro transcription and protein expression, with T7 promoter.DepositorInsertPCQAP (MED15 Human)
UseTagsExpressionBacterialMutationContains amino acids 5-78 fused to C-terminal of …PromoterAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianMutationPromoterhU6Available sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-ACSL3-sfGFP(C) HDR template
Plasmid#129413PurposeHDR tempalte for tagging of endogenous human ACSL3 C-terminus with sfGFPDepositorInsertACSL3 HDR template (ACSL3 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only