We narrowed to 22,785 results for: Ide
-
Plasmid#184666PurposeHuman alpha-tubulin labelled with near-infrared fluorescent protein miRFP670nano3DepositorInsertmiRFP670nano3-human alpha-tubulin
TagsmiRFP670nano3ExpressionMammalianPromoterCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SDHA_WT
Plasmid#82278PurposeGateway Donor vector containing SDHA, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CTNNB1_p.S33A_S37A_T41A_T45A
Plasmid#82176PurposeGateway Donor vector containing CTNNB1 , part of the Target Accelerator Plasmid Collection. (Please note this plasmid contains S45A mutation, not T45A)DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RPS6KA4
Plasmid#23641DepositorInsertRPS6KA4 (RPS6KA4 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pJQ200
Plasmid#78496PurposeBase vector for construction of series of suicide plasmids for gene replacement in ProteobacteriaDepositorTypeEmpty backboneUseSuicide vectorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
human p53-Δ(325-355)
Plasmid#24871DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
PABPC1
Plasmid#155805PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
SacI ML GFP Strand 11 Long
Plasmid#164120PurposeDetect the long Mitochondria-Endoplasmic reticulum contact along with the OMMGFP1-10DepositorInsertSacI ML GFP Strand 11 Long
ExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SacI ML GFP Strand 11 Short
Plasmid#164121PurposeDetect the short Mitochondria-Endoplasmic reticulum contact along with the OMMGFP1-10DepositorInsertSacI ML GFP Strand 11 Short
ExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RASA1_WT
Plasmid#81778PurposeGateway Donor vector containing RASA1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS315e_pGal-dCas9-PmCDA1
Plasmid#79615PurposeExpresses dCas9-PmCDA1 in yeast cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionYeastMutationD10A and H840A for nuclease deficient Cas9PromoterpGal1Available SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-D2cpV
Plasmid#37471DepositorInsertD2cpv second generation cameleon (calcium sensor)
ExpressionMammalianPromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET14-Encap
Plasmid#86405PurposeExpresses T. maritima encapsulin in E. coliDepositorInsertEncapsulin
ExpressionBacterialPromoterT7Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENN496_miniCRISPRcharm_dSaCas9
Plasmid#220837Purposemini CRISPRcharm expression in mammalian cellsDepositorInsertmini CRISPRcharm
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-16b-10His-TEV-MCES_VACCA_D1_D12
Plasmid#203671PurposeThe D1 and D12 subunits of the vaccinia capping enzyme were cloned in tandem into the vector pET-16b (Novagen). An N-terminal His10 tag was added to the D1 subunit and the original factor Xa cleavageDepositorInsertMCES_VACCA_D1_D12
Tags10xHisExpressionBacterialAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
bNS2B47NS3
Plasmid#155320Purposeco-expression of DENV4 47 peptides from NS2B cofactor and NS3 full lengthDepositorInsertCo expression of DENV4 NS3 full length protein with 47 peptides from NS2B cofactor
TagsHis tagExpressionBacterialMutationWTPromoterT7Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Stuffer
Plasmid#106248PurposeDestination vector for U6::gRNA expression cassetteDepositorTypeEmpty backboneUseAAVAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only