We narrowed to 19,393 results for: IRE
-
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-18
Plasmid#172763PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-18; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-18
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(1)-T2A-LexA::QFAD-Hsp70
Plasmid#62948PurposeCreating LexA::QF drivers from MiMIC lines with inserts into coding introns in Phase 1DepositorInsertT2A-LexA::QFAD-Hsp70
Available SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Dmrt1
Plasmid#41083DepositorAvailable SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx30
Plasmid#188988PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3
Plasmid#62957PurposeTriplet donor for in vivo RMCE with MiMIC inserts to make Gal4 driver.DepositorInsertT2A-Gal4 in three phases
Available SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPIB_P2A_Hygro_Barcode
Plasmid#120483PurposeBarcoded lentiviral vector to express SPIB in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUWR-Cad-Venus
Plasmid#58328PurposeDestination vector for inserting ubi-Cad-Venus to Drosophila melanogaster genomeDepositorInsertCad-Venus
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pET21-pelB-LaG-10
Plasmid#172743PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-10; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-10
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPP5238
Plasmid#128711PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopG1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-KLF7-200-GFPfr1
Plasmid#169799PurposeTHe donor vector for the KLF7 gene locus.DepositorInsertDonor sequence to KLF7 neighbouring region for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted the sequence …Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
WT (REP10)
Plasmid#21368DepositorInsertautosomal dominant polycystic kidney disease type I (PKD1 Human)
ExpressionMammalianAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-42
Plasmid#172758PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-42; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-42
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Krox20 promoter pGL3-TATA
Plasmid#21260DepositorAvailable SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRcCMV Cep164 (Nigg CW325)
Plasmid#41148DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK-Cas9-gate
Plasmid#113743PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants.DepositorInsertCas9
UseCRISPR; Gateway destination vectorPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pATP403red-hENT1
Plasmid#166027PurposeExpresses human equilibrative nucleoside transporter 1 (hENT1)DepositorInserthuman equilibrative nucleoside transporter 1 (SLC29A1 Human)
UseSynthetic BiologyExpressionYeastPromoterpTDH3Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMBA333
Plasmid#214745PurposeMedium copy thyA-infA plasmid containing gfp and no antibiotic resistance gene (ARG)DepositorInsertBBa_J23119-RiboJ-RBS(21992)-gfpmut3
ExpressionBacterialAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-UMPS-3xFLAG
Plasmid#87975Purpose3rd generation lentiviral vector for Expression of UMPS in mammalian cellsDepositorAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCPP5951
Plasmid#128719PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopR1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGREAT26
Plasmid#170914PurposeGoldenBraid Double Transcriptional Unit - pEstradiol_Inducible_E-Luc_NtEUt+pNOS_Red-F_NOStDepositorInsertE-Luc
UseLuciferase and Synthetic BiologyExpressionPlantMutationc.375C>T silent mutation to remove BbsI site (…PromoterpEstradiol_InducibleAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-6
Plasmid#172741PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-6; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-6
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK C
Plasmid#37015DepositorAvailable SinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
NylB'-SCY_pET21b
Plasmid#215417PurposeExpression construct for NylB'-SCY gene, codon optimized for expression in E. coliDepositorInsertNylB'-SCY
ExpressionBacterialMutationR187S/F264C/D370YAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
drebrin-His
Plasmid#40363DepositorAvailable SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNLuc
Plasmid#118058PurposeGBPart - NLuc Luciferase CDSDepositorInsertNano Luciferase
UseLuciferase and Synthetic Biology; GbpartAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3 6A
Plasmid#24382DepositorInsertFOXO3 (FOXO3 Human)
TagsFLAGExpressionMammalianMutationT179A, S399A, S413A, S555A, S588A, and S626AAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-41
Plasmid#172757PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-41; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-41
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMA_Int
Plasmid#110096PurposeE. coli replicative vector which contains the mycophage integrase gene required for the attP/attB integration. Is co-transformed in trans together with pFLAG_attP, but cannot replicate in mycobacteria, and is thus lost shortly after electroporation.DepositorInsertmycophage integrase
UseRequired for transformation of attb integrating v…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJH3449
Plasmid#179576PurposePacr-5::tomm20::miniSOG-SL2::BFP unc-54 3' UTR C.elegans B-MN/others and others expression of miniSOG-SL2 BFPDepositorAvailable SinceMarch 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCPP5108
Plasmid#128726PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAA1-2
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5107
Plasmid#128725PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAA1-1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-rnc-sfGFP
Plasmid#51560PurposeGene encoding E. coli RNaseIII cloned as a N terminal translational fussion with superfolder GFP. Expression driven by arabinose (backbone is pBAD24).DepositorInsertrnc (rnc E. coli)
TagsGLESTCRHASLAVLADERRFSA and superfolder GFPExpressionBacterialMutationContains additonal aa at the end of the sfGFP in …Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRL K-ras 3'UTR
Plasmid#14804DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJH3626
Plasmid#179630PurposePacr-2(s)::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans A/B-MN-specific expression of miniSOG-SL2::RFPDepositorAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pF208wt-luc
Plasmid#122143PurposeFor luciferase expressionDepositorAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
C1-MPAct(delta1-6)-mRuby3
Plasmid#155223PurposeF-actin bidning mutant of MPActDepositorInsertMutated version of F-tractin (aa 15-52 of rat ITPKA) fused to mRuby3 C-term tagged with the CaaX sequence derived from Kras4b
TagsmRuby3ExpressionMammalianMutationDeletion of first 6 AA from F-tractin (9-14 from …Available SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCPP5537
Plasmid#128730PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInsertHopAO1
ExpressionBacterialAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ3A
Plasmid#198174PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 μ3A fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 μ3A
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationsilent substitution in codon 225PromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ3B
Plasmid#198175PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 μ3B fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 μ3B
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPS0263
Plasmid#133228PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with PsNifH (pOGG043), gusA (pOGG083) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0262
Plasmid#133227PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with PsNifH (pOGG043), celB (pOGG050) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCPP5099
Plasmid#128714PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopK1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5328
Plasmid#128721PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopU1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5306
Plasmid#128712PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopH1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5571
Plasmid#128713PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopI1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5539
Plasmid#128728PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAF1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only