We narrowed to 27,839 results for: CAT
-
Plasmid#206429PurposeA vector backbone domesticated for SapI (pCC1BAC-based), contains elements for selection, maintenance, and propagation in S. cerevisiae (TRP1) and E. coli (cat).DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pFCM1
Plasmid#64948Purposesource of CmR FRT cassetteDepositorInsertFRT-cat-FRT
ExpressionBacterialAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pG5ElbLuc
Plasmid#89341PurposeThe plasmid pG5ElbLuc was prepared from pG5E1bCAT by replacing the CAT gene (EcoRI and Sty I fragment) with the firefly luciferase gene (from pGEM-Luc) as a 1745bp StuI-Hind111 fragment.DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pFunnyfarm
Plasmid#24755DepositorInsertCAT-ccdB cassette
UseGateway-adapted entry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
pAAV-CAG-NIR-GECO2G (AAV9)
Viral Prep#159605-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-NIR-GECO2G (#159605). In addition to the viral particles, you will also receive purified pAAV-CAG-NIR-GECO2G plasmid DNA. CAG-driven expression of the near-infrared calcium indicator NIR-GECO2G. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G (AAV2)
Viral Prep#159605-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CAG-NIR-GECO2G (#159605). In addition to the viral particles, you will also receive purified pAAV-CAG-NIR-GECO2G plasmid DNA. CAG-driven expression of the near-infrared calcium indicator NIR-GECO2G. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G (AAV1)
Viral Prep#159605-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-NIR-GECO2G (#159605). In addition to the viral particles, you will also receive purified pAAV-CAG-NIR-GECO2G plasmid DNA. CAG-driven expression of the near-infrared calcium indicator NIR-GECO2G. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV (AAV1)
Viral Prep#140137-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-iFlpV (#140137). In addition to the viral particles, you will also receive purified pAAV-EF1a-iFlpV plasmid DNA. EF1a-driven, light-inducible iFlpV recombinase for spatiotemporally precise optogenomic modifications. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iDreV (AAV1)
Viral Prep#140136-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-iDreV (#140136). In addition to the viral particles, you will also receive purified pAAV-EF1a-iDreV plasmid DNA. EF1a-driven, light-inducible iDreV recombinase for spatiotemporally precise optogenomic modifications. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iCreV (AAV1)
Viral Prep#140135-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-iCreV (#140135). In addition to the viral particles, you will also receive purified pAAV-EF1a-iCreV plasmid DNA. EF1a-driven, light-inducible iCreV recombinase for spatiotemporally precise optogenomic modifications. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE (AAV9)
Viral Prep#225708-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE (#225708). In addition to the viral particles, you will also receive purified pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma-targeted expression of genetically encoded voltage indicator ASAP5. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1αAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE (AAV1)
Viral Prep#225707-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hsyn-ASAP5-Kv2.1-WPRE (#225707). In addition to the viral particles, you will also receive purified pAAV-hsyn-ASAP5-Kv2.1-WPRE plasmid DNA. Syn-driven, soma-targeted expression of genetically encoded voltage indicator ASAP5. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE (AAV9)
Viral Prep#179464-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-JEDI-2P-WPRE (#179464). In addition to the viral particles, you will also receive purified pAAV-hSyn-JEDI-2P-WPRE plasmid DNA. hSyn-driven expression of the genetically encoded voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE (AAV9)
Viral Prep#179463-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-JEDI-2P-Kv-WPRE (#179463). In addition to the viral particles, you will also receive purified pAAV-hSyn-JEDI-2P-Kv-WPRE plasmid DNA. hSyn-driven expression (soma and AIS-localized) of the genetically encoded voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron-ST (AAV1)
Viral Prep#119036-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hsyn-flex-Voltron-ST (#119036). In addition to the viral particles, you will also receive purified pAAV-hsyn-flex-Voltron-ST plasmid DNA. Synapsin-driven, cre-dependent expression of genetically encoded fluorescent voltage indicator Voltron1 with a soma-targeting sequence. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV (AAV PHP.eB)
Viral Prep#140137-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-EF1a-iFlpV (#140137). In addition to the viral particles, you will also receive purified pAAV-EF1a-iFlpV plasmid DNA. EF1a-driven, light-inducible iFlpV recombinase for spatiotemporally precise optogenomic modifications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iDreV (AAV PHP.eB)
Viral Prep#140136-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-EF1a-iDreV (#140136). In addition to the viral particles, you will also receive purified pAAV-EF1a-iDreV plasmid DNA. EF1a-driven, light-inducible iDreV recombinase for spatiotemporally precise optogenomic modifications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-WPRE (AAV1)
Viral Prep#179460-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-DIO-JEDI-2P-WPRE (#179460). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-JEDI-2P-WPRE plasmid DNA. EF1a-driven, Cre-dependent expression of voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagscEGFP (Cre-dependent)Available SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (AAV1)
Viral Prep#179459-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (#179459). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma and AIS-localized expression of voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagscEGFP (Cre-dependent)Available SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iCreV (AAV PHP.eB)
Viral Prep#140135-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-EF1a-iCreV (#140135). In addition to the viral particles, you will also receive purified pAAV-EF1a-iCreV plasmid DNA. EF1a-driven, light-inducible iCreV recombinase for spatiotemporally precise optogenomic modifications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#167547PurposeUsed for CRISPR-Cas9 mediated recombineering in Enterococcus. Can clone desired gRNA using BsaI digestion.DepositorInsertschloramphenicol acetyl transferase
pUC19 origin of replication
UseCRISPRExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pet28a-ClbB-NRPS-NHis
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIOM17
Plasmid#20870DepositorInsertaphA::cat
ExpressionBacterialAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL5
Plasmid#72989PurposeRBS_M2DepositorInsertM2 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL11
Plasmid#72995PurposeRBS_L4DepositorInsertL4 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL4
Plasmid#72988PurposeRBS_H5DepositorInsertH5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL8
Plasmid#72992PurposeRBS_L1DepositorInsertL1 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-L1U1H09
Plasmid#73008PurposeL1U1H09 terminatorDepositorInsertL1U1H09 terminator
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pR6Ko2_FRTcamFRT
Plasmid#243904PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. Ready to be amplified to make gene knockouts.DepositorInsertcat
ExpressionBacterialAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBSKa1_FRTcamFRT
Plasmid#243836PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. May be omega-assembled with another transcription unit.DepositorInsertcat
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBSKa2_FRTcamFRT
Plasmid#243841PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. May be omega-assembled with another transcription unit.DepositorInsertcat
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL6
Plasmid#72990PurposeRBS_M3DepositorInsertM3 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only