We narrowed to 10,326 results for: ada
-
Plasmid#179897PurposeDonor with homologous arms for Rab11a to knock in DExCon-mNeonGreen moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsmNeonGreenExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-M2WA-siRNAres_S
Plasmid#147519PurposeMammalian Expression of HsTNRC6A-M2WA-siRNAresDepositorInsertHsTNRC6A-M2WA-siRNAres (TNRC6A Human)
ExpressionMammalianMutationfour non silent mutations A339T, R934G, D1289G, a…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-CIM1mut-siRNAres_R
Plasmid#147413PurposeMammalian Expression of HsTNRC6A-CIM1mut-siRNAresDepositorInsertHsTNRC6A-CIM1mut-siRNAres (TNRC6A Human)
ExpressionMammalianMutationthree non silent mutations A339T, R934G, and K157…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-i5-TEV-Strep
Plasmid#180314Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1-i5DepositorTagsTEV-StrepExpressionBacterialMutationSEPT9_i1-i5Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S22A S23A-msfGFP
Plasmid#180338Purposemammalian expression of human SEPT9_i1 S22A S23A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S22A S23APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R10A R15A-msfGFP
Plasmid#180336Purposemammalian expression of human SEPT9_i1 R10A R15A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R10A R15APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S12A S13A-msfGFP
Plasmid#180337Purposemammalian expression of human SEPT9_i1 S12A S13A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S12A S13APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shRps6ka2-3
Plasmid#180390PurposeProducing AAV that encodes mouse Rps6ka2 (Rsk3) shRNA-3 with miR-E backboneDepositorAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shRps6ka2-2
Plasmid#180389PurposeProducing AAV that encodes mouse Rps6ka2 (Rsk3) shRNA-2 with miR-E backboneDepositorAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shRps6ka2-1
Plasmid#180388PurposeProducing AAV that encodes mouse Rps6ka2 (Rsk3) shRNA-1 with miR-E backboneDepositorAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+Q111R+N122D
Plasmid#167175PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with Q111R and N122D mutations in Sf9 cellsDepositorInsertsATP1A1-S+Q111R+N122D
ATP1B1
ExpressionBacterial and InsectMutationChanged Q at 111 to R and changed N at 122 to DPromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+10subs
Plasmid#167176PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with 10 R mutations in Sf9 cellsDepositorInsertsATP1A1-S+10R
ATP1B1
ExpressionBacterial and InsectMutationChanged A at 112 to T; E at 116 to D; I at 135 to…PromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+12subs
Plasmid#167177PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with 12 R mutations in Sf9 cellsDepositorInsertsATP1A1-S+12R
ATP1B1
ExpressionBacterial and InsectMutationChanged Q at 111 to R; A at 112 to T; E at 116to …PromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mDrc3-PA
Plasmid#176467PurposeExpression vector of mouse dynein regulatory complex subunit 3 (Drc3) tagged with PA at C-terminus.DepositorAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#2
Plasmid#174143PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO GLTP
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP-MIOX
Plasmid#166682PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase fused to VP2C-GFP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Synthetic, Mouse, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterGAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-mHdac1-L2
Plasmid#122307PurposeExpresses sgRNA targeting mouse Hdac1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Hdac1 (Hdac1 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-chiRNA_dCrkgRNA1
Plasmid#131139PurposeEncodes gRNA targeting Drosophila crk locus. Cuts 110bp upstream of the transcription start site. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-chiRNA_dCrkgRNA2
Plasmid#131140PurposeEncodes gRNA targeting Drosophila crk locus. Cuts 99bp beyond the 3' UTR. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).DepositorAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mAmber
Plasmid#105792PurposeExpression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the C-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mAmberExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mAmber-TEV
Plasmid#105775PurposeExpression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the N-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmAmber-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLuc-Optop38i-lsm
Plasmid#89747PurposeExpression of light-regulated p38 inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor MK3BD3-13FDepositorInsertOptop38i lit-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationI539E mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi-lsm
Plasmid#89746PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor JIP11DepositorInsertOptoJNKi lit-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationI539E mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi-dsm
Plasmid#89745PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor JIP11DepositorInsertOptoJNKi dark-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationC450A mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
NC11 pCDNA3.1 VENUS WTX K292N
Plasmid#36966DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only