We narrowed to 9,450 results for: tre promoter
-
Plasmid#37380DepositorInsertPolIII-Renilla control reporter (RpIII128 Fly)
UseLuciferaseExpressionMammalianPromoterRNA PolIII 128 subunit (RpIII128)Available SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MITF_P2A_Hygro_Barcode
Plasmid#120460PurposeBarcoded lentiviral vector to express MITF in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYOD1_P2A_Hygro_Barcode
Plasmid#120464PurposeBarcoded lentiviral vector to express MYOD1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-OVOL1-T2A-PuroR
Plasmid#162347PurposeLentiviral expression of OVOL1 under the control of the TetON promoterDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT040 lenti MCS pEF mIFP WPRE
Plasmid#161929PurposeLentiviral expression of mIFP with multiple cloning site upstream the pEF promoterDepositorInsertmIFP
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpEFAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-WPRE
Plasmid#127864PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP fusion protein under the hSyn promoterDepositorAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-GL
Plasmid#83342Purposefor Gateway cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsGFP::Luciferase(nls)ExpressionInsectAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eGFP-SynaptoZip
Plasmid#122525PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoterDepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-RR
Plasmid#83343Purposefor Gateway cloning of promoter elements upstream of a mCherry::Renilla(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsmCherry::Renilla(nls)ExpressionInsectAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-miniSOG-VAMP2-citrine
Plasmid#50969PurposeAAV2 transfer vector containing the InSynC (miniSOG-VAMP2-citrine) constructDepositorInsertminiSOG-VAMP2-citrine (Vamp2 Mouse, Arabdopsis thaliana)
UseAAVTagscitrine and miniSOGPromoterhuman synapsin promoterAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-mCherry-SynaptoZip
Plasmid#177317PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by hPGK promoterDepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_POU1F1_P2A_Hygro_Barcode
Plasmid#120473PurposeBarcoded lentiviral vector to express POU1F1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
HSC1-D4Z4-GiP
Plasmid#58542PurposeDerived from HSC1-GiP where the D4Z4 insulator is cloned upstream of the EF1 alpha promoterDepositorInsertsEnhanced Green Fluorescence Protein, Puromycin resistance gene
D4Z4 repeat, partial
UseRetroviralExpressionMammalianPromoterHuman EF1-alphaAvailable SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E WT
Plasmid#110123PurposeExpresses Flag-tagged D. melanogaster Hel25EDepositorAvailable SinceOct. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/FLAG-hPMR1-Tev-Bio
Plasmid#80125PurposeExpresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tagsDepositorInsertPXDNL-003 (PXDNL Human)
TagsFLAG and biotinylationExpressionMammalianPromoterCMV promoterAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUASp-FMW-attB-AthHen1
Plasmid#104957PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila germline tissues using Gal4 driversDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Pfba1-PYC-Trpl15a
Plasmid#127738PurposeYeast pathway position 5. PYC transcription unit with the FBA1 promoter and RPL15A terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPfba1Available SinceJan. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASt-FMW-attB-AthHen1
Plasmid#104958PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila using somatic tissue Gal4 driversDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
pSG059
Plasmid#214262PurposePaFtsH2-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInserttLST accessory element PaFtsH2 protease of Pseudomonas aeruginosa SG17M
Tags6x His-tag and 6xHis-tagExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
10X PRE TK luc
Plasmid#206162PurposeLuciferase reporter construct containing 10 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert10X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
8X PRE TK luc
Plasmid#206161PurposeLuciferase reporter construct containing 8 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert8X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
6X PRE TK luc
Plasmid#206160PurposeLuciferase reporter construct containing 6 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert6X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW pHluorin-SYT9 IRES mRuby3
Plasmid#195698PurposeLentiviral plasmid encoding SYT9 with an N-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Syt9 IRES mRuby3
Plasmid#195700PurposeLentiviral plasmid encoding full-length mouse SYT9 followed by an internal ribosomal entry site followed by mRuby under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP
Plasmid#202053PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHELDepositorInsertAtWUS E. Coli Codon Optimized (WUS Mustard Weed)
Tags6xHis and GFP11ExpressionBacterialPromoterT7 PromoterAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-nsp7
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABR mCherry-Bcd-LEXY
Plasmid#182596PurposeDrosophila integration plasmid expressing mCherry-Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3R2
Plasmid#179163PurposeExpression vector of human protein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2 Human)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mPpp3r2
Plasmid#179161PurposeExpression vector of mouse protein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2 Mouse)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hSPATA33-8xHIS-1D4
Plasmid#179133PurposeExpression vector of human spermatogenesis associated 33 (SPATA33) tagged with 8XHIS and 1D4 at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only