167,785 results
-
Viral Prep#37825-AAV6.TPurposeReady-to-use AAV6 trial size particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only
-
mito-V5-APEX2
Plasmid#72480PurposeExpresses APEX2 in mitochondriaDepositorInsertAPEX2
TagsV5ExpressionMammalianPromoterCMV promoterAvailable SinceApril 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMasterK
Plasmid#165081PurposeEpisomal expression of reprogramming factors.DepositorInsertsUseEpisomalExpressionMammalianAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
N1-G-Ca-FLITS
Plasmid#191465PurposeGenetically encoded calcium sensor (GECI) G-Ca-FLITS that reports with a lifetime changeDepositorInsertG-Ca-FLITS
ExpressionMammalianAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-puro-EGFP-RPA194
Plasmid#179237Purposeoverexpression in human cellsDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOS007: PercevalHR ATP/ADP sensor (cytosolic)
Plasmid#163061PurposePercevalHR ATP/ADP sensor (cytosolic)DepositorInsertPercevalHR
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCAS9-VP64_GFP
Plasmid#61422PurposeExpresses dCAS9-VP64 activator with 2A GFPDepositorHas ServiceConcentrated Lentiviral PrepInsertdCAS9(D10A,H840A)-VP64_2A_GFP
UseCRISPR and LentiviralExpressionMammalianMutationD10A and H840A in Cas9PromoterEF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDL278_P23-DsRed-Express2
Plasmid#121505PurposeE. coli-streptococcal shuttle vector that expresses rfpDepositorInsertDsRed-Express2
UseE. coli streptococcal shuttle vectorPromoterP23Available SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-TREX1
Plasmid#27219DepositorAvailable SinceJan. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pK036.TRE-Flpe-WPRE (Supernova)
Plasmid#85007PurposeFor Flpe/FRT-based Supernova, pK036 should be used with pK068 etc.DepositorInsertNLS-FLPe-WPRE
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTK168_mCherry-H2B
Plasmid#46363Purposevisualizes chromosomesDepositorInsertH2B (H2BC11 Human)
UseRetroviralTagsmCherryExpressionMammalianMutationD26G, V119I and S125DPromoterpBABEAvailable SinceAug. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
scAAV-Cre
Plasmid#177933PurposeExpresses Cre-recombinase and can be packaged into AAV particles.DepositorInsertCAG-Cre
UseAAVExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFlagCMV2-EFP
Plasmid#12449DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCROPseq-VEX-optimized-scaffold
Plasmid#203321PurposeModified CROPseq vector for efficient CRISPR screens in hematopoiesisDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (AAV PHP.eB)
Viral Prep#104491-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (#104491). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven, Cre-dependent, GCaMP7s calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bison sgRNA library
Pooled Library#169942PurposeThe BISON CRISPR library targets 713 E1, E2, and E3 ubiquitin ligases, deubiquitinases, and control genes and contains 2,852 guide RNAs. It was cloned into the pXPR003.DepositorUseLentiviralAvailable SinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOSCAR
Plasmid#29639DepositorTypeEmpty backboneAvailable SinceSept. 19, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE
Plasmid#85452PurposeLentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker.DepositorInsertU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro
UseCRISPR and LentiviralTagsNLSExpressionMammalianAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-H2A
Plasmid#36207PurposeIn vivo visualization of the nucleus (can be used for colocalization studies)DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
p7141 pHAGE-P-CMVt-N-HA-GAW-MUS81
Plasmid#100157PurposeExpresses MUS81DepositorAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCM433
Plasmid#15670DepositorTypeEmpty backboneUseBacterial allelic exchange vectorAvailable SinceAug. 31, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTF-ahpC-rfp
Plasmid#153035PurposeFor CRISPR-Cas12a genome editing in E. coli. Contains a constituitively expressed CRISPR array targeting the ahpC gene in E. coli and donor DNA to insert an rfp translational fusion in the ahpC gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-TurboID-NES_pLX304
Plasmid#202008Purposeexpresses TurboID in the mammalian cytosol, lentiviral vectorDepositorInsertFlag-TurboID-NES
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-R-GECO1
Plasmid#46021PurposeRed intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertR-GECO1
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAHYB-GFP
Plasmid#85074PurposeExpression of GFP in Pichia pastorisDepositorInsertGFP
ExpressionYeastPromoterAOX1Available SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB2
Plasmid#195282PurposeBicistronic DTR and Puromycin resistance for positive/negative selectionDepositorAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
C321.∆A ompT- rne- endA- lon-
Bacterial Strain#182775PurposeRecoded E. coli MG1655 strain with UAG termination function removed (RF1 is deleted); ompT, rne, endA, lon inactivatedDepositorBacterial ResistanceAmpicillinAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only