We narrowed to 10,027 results for: CAG
-
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lys-eMagB-iRFP
Plasmid#162249PurposeBlue-light dependent heterodimerization systemDepositorInsertp18-eMagB-iRFP
ExpressionMammalianPromoterbeta-actin promoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR-Hyg
Plasmid#158708PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorAvailable sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable sinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pERB221
Plasmid#61502Purposeconst. CenpB-GFP-Halo + mCherry-DHFRDepositorInsertsCenpB-GFP-Halo
mCherry-DHFR
TagsHaloTag and mCherryExpressionMammalianAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_gRNA_1
Plasmid#196625PurposeKnock-out STING in murine cells, gRNA 1.DepositorAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 TNRC6A
Plasmid#20021DepositorInsertTrinucleotide repeat containing 6A (TNRC6A Human)
UseGateway CloningAvailable sinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
SV40 basal promoter-LacZ
Plasmid#18816DepositorInsertSV40 basal promoter-LacZ
ExpressionMammalianAvailable sinceJuly 27, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-PIK3C2B
Plasmid#161989PurposeMammalian expression vector containing PIK3C2B tagged with GFPDepositorInsertPIK3C2B (PIK3C2B Human)
TagsGFPExpressionMammalianMutationsiRNA resistance to siRNA#2 with 4 silent mutatio…Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1-tdTomato targeting vector (compatible with CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA)
Plasmid#194728PurposeAAVS1-tdTomato targeting vector, compartible with Cpf1DepositorInserttdTomato
UseCRISPR; Knockin targeting plasmidAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-GFP (AAV6)
Viral prep#37825-AAV6PurposeReady-to-use AAV6 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMU-LEr
Plasmid#61185PurposeFluorescent reporter for late endosome mCherry-MtRAB5A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB5A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only