We narrowed to 60,538 results for: Gene
-
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Ntng1.d-AP-His
Plasmid#71987PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH671-SUP35-H348Q
Plasmid#29732DepositorInsertSUP35 gene encoding translation release factor 3 from S. cerevisiae (SUP35 Budding Yeast)
ExpressionYeastMutationH348Q mutant gene of SUP35 including genomic sequ…Available SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-multi-v1 barcode library
Pooled Library#206045PurposeThe CellTag multi library of barcodes can be used to clonally label cells with DNA barcodes. These barcodes can be profiled directly with single-cell RNA and ATAC sequencing, to allow clonal trackingDepositorUseLentiviralAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human Lipid Droplet and Metabolism Library
Pooled Library#191535PurposeTargets 1,196 genes related to lipid droplet biology and cell metabolism.DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Gouda in pRDA_118 backbone
Pooled Library#136987PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brie mouse genome-wide library.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHPdesteGFP
Plasmid#24566DepositorInsert
UseReporter constructTagseGFPAvailable SinceMay 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL2
Plasmid#39178PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
RF4
Bacterial Strain#62072PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. aspC tyrB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SHP2(WT)@pLKO-Trex-SBP
Plasmid#85457PurposeGene expressionDepositorAvailable SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MK01
Bacterial Strain#195090PurposeImproved E. coli strain created by knocking out the endogenous lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783 that overcome the all-or-none response of araBAD promoter (PBAD).DepositorBacterial ResistanceChloramphenicolAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.0-mIghg1
Plasmid#127158PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG1 isotypeDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mini-human AsCpf1-based human genome-wide knockout library
Pooled Library#130630PurposeKnockout library targeting 16,977 genes. Each gene is targeted by an AsCpf1(AsCas12a)-based array containing 3-4 guides concatenated in one vector.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-hGTB
Plasmid#26196DepositorInsertTet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
UseAAV and Cre/Lox; Adeno-associated virusMutationF2A has 2A cleavage site deleted, producing htTA-…Available SinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
ML14
Bacterial Strain#61911PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. tyrA gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-Fc-His
Plasmid#72097PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
DHL708
Bacterial Strain#98417PurposeBacterial Strain with Genotype: MC4100 ∆clpPXDepositorBacterial ResistanceStreptomycinAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cultivarium POSSUM Toolkit
Plasmid Kit#1000000234PurposeGolden Gate genetic toolkit developed to help researchers identify functional plasmids and establish genetic tractability in non-model bacteria.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden Gate (Loop)Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuclear-EKAR4
Plasmid#174439PurposeNuclear-targeted EKAR4.DepositorInsertnuclear-EKAR4
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS:Zebrabow-B
Plasmid#118216PurposeFor broad gal4 inducible expression of Brainbow in zebrafishDepositorInsertBrainbow 1.0 L
UseZebrafish expressionAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-gamma-tubulin
Plasmid#87956PurposeExpresses human gamma-tubulin with a GFP-tag on the C-terminal of the proteinDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene …Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
p7SL-neo-TET
Plasmid#51285Purposeexpresses human 7SL RNA, using its own polIII enhancer, and tagged with the self splicing intron neo cassetteDepositorInsert7SL RNA (RN7SL2 Human)
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoter7SL upstream pollII enhancerAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
BIOFAB
Plasmid Kit#1000000037PurposeCollection of precisely quantitated bacterial transcription and translation initiation elements for controlled and reliable expression in E. coli.DepositorApplicationGene Expression and LabelingVector TypeBacterial ExpressionAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
Vaccinia Virus ORF Library
Plasmid Kit#1000000009PurposeA set of plasmids containing every open reading frame of the vaccinia virus.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
RF1
Bacterial Strain#61962PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. glyA gene deletedDepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSEVA331Bb
Plasmid#78269PurposepSEVA331 with Biobrick multiple cloning siteDepositorTypeEmpty backboneAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only