We narrowed to 1,092 results for: control gRNA
-
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Human Brunello kinome pooled library, guides 1-4 in lentiCRISPRv2 backbone
Pooled library#75314PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPRIME-CMV-LNGFR-FF3
Plasmid#11666Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of LNGFR and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsLNGFRExpressionMammalianAvailable sinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TREX-GFP-FF3
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable sinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TGmiR-Luc
Plasmid#25745PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.DepositorInsertLuciferase miR-shRNA
UseLentiviral and RNAiTagsGFPExpressionMammalianAvailable sinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
ExpressionMammalianAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human Brunello kinome pooled library, guides 1-4 in lentiGuide-Puro backbone
Pooled library#75312PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pmCherry_sgRNA-ver2
Plasmid#126776PurposegRNA expression vector with mCherry transfection control, does not contain the direct repeat of the truncated guideRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA (for SpCas9)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102797PurposeRetrovirus for testing CRISPR KO activity (empty) - non-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBACH2-sgRNA8 (BACH2 Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBFC0687
Plasmid#186692PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_2xBsaI_NT (Guide Stuffer) gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBFC0694
Plasmid#186693PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_lacZ_α_1 gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9–mKate2ps
ExpressionMammalianAvailable sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertUseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNASAM(gEmpty)-TREGFP-PGKpuroBFP-W
Plasmid#112926PurposeCRISPR-a reporter assay lentiviral vector (empty gRNA control)DepositorInserthU6-gRNASAM(empty), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only