167,910 results
-
Plasmid#91764PurposeBacterial expression of a fluorescent protein, monomeric Orange (mOrange)DepositorInsertmonomeric Orange
TagsHexa-Histidine tag, Xpress epitope for detection …ExpressionBacterialPromoterT7Available SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA HA HP1 alpha
Plasmid#24078DepositorAvailable SinceOct. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TnsC)-sgRNA_entry (CJT113)
Plasmid#181792PurposeExpresses 3-component ShHELIX containing a Cas12k-TnsC fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTniQ, ShCas12k-ShTnsC
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-TO-Puromycin-mVenus-MAP
Plasmid#44118DepositorTypeEmpty backboneTagsmVenus-MAPExpressionMammalianAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
GPX4
Plasmid#38797PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Bxb1-LP-v2-TC
Plasmid#194326PurposeAAVS1 targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-BiFC
Plasmid#87856PurposepETDUET-1 based vector for use in BiMolecular Fluorescence Complementation based assays. MCS at 5' of each BiFC fragment.DepositorInsertsEncodes for MCS & C-term half of mVenus
Encodes for MCS & N-term half of mVenus
TagsBiFC C-terminal fragmentExpressionBacterialPromoterT7Available SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSC-ISL1-T2A-LHX3
Plasmid#90215PurposeTo convert human skin fibroblasts into induced motor neurons (hiMN) in combination with NGN2, Sox11, FGF2 and two small molecules, forskolin and dorsomorphin.DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPSint
Plasmid#149421PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted into the IV2 intron in the GFP reporter gene.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloAktKAR2.2-T2A-EGFP
Plasmid#216494PurposeExpression of chemigenetic Akt biosensor (low basal brightness, extremly high dynamic range) and EGFP transfection marker in mammalian cellsDepositorInsertHaloAktKAR2.2
TagsT2A-EGFPExpressionMammalianPromoterCMVAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGDP1 NDM-1
Plasmid#112883PurposeThis plasmid is part of the Minimal Antibiotic Resistance Platform (ARP) Kit (Addgene #1000000143). Low copy-number plasmid that constitutively expresses genes using the Pbla promoter.DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK2
Plasmid#225142PurposeExpresses MYC-tagged human TRAK2DepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAW12.lentiguide.GFP
Plasmid#104374PurposeGFP vector for cloning in guidesDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PGK-HALO-CTERM-GFP
Plasmid#185777PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, HaloMutationnonePromoterPGKAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b KD
Plasmid#16262DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Human CRISPR-Cas9 Deletion Library - Membrane proteins
Pooled Library#101929PurposeBassik lab Human CRISPR-Cas9 Deletion Library - Membrane proteins. Coexpresses mCherry.DepositorExpressionMammalianUseCRISPRAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR5'_ubi
Plasmid#27320DepositorInsertzebrafish ubiquitin promoter (ubb Zebrafish)
UseMultisite gateway 5' entry vectorAvailable SinceFeb. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 (AAV1)
Viral Prep#172922-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 (#172922). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 plasmid DNA. Syn-driven expression of calcium sensor jGCaMP8m in axons with cytosolic expression of mRuby3. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby3Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTU-DO-URA
Plasmid#160004PurposeLow-copy expression vector for K. marxianus, uracil selectionDepositorTypeEmpty backboneUseKluyveromyces marxianusTagsn/aExpressionYeastPromotern/aAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
mito-PAGFP
Plasmid#23348PurposeExpresses a mitochondrial matrix-targeted photoactivable GFP that enables detection and quantification of organelle fusion in living cells.DepositorInsertPAGFP
TagsmitoExpressionMammalianAvailable SinceApril 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-rab11 WT
Plasmid#12674DepositorAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDule2-Mb haloTyrRS C6
Plasmid#160378PurposeC6 HaloTyrosine tRNA synthatase and cognate amber suppressing tRNA derived from M. barkeri.DepositorInsertC6 HaloTyrosine tRNA synthatase
UseSynthetic BiologyExpressionBacterial and MammalianMutationL270S, Y271L, N311G, C313TAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TLR9-YFP
Plasmid#13642DepositorAvailable SinceJune 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-mCherry (AAV5)
Viral Prep#26976-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-hChR2(H134R)-mCherry (#26976). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-mCherry plasmid DNA. Synapsin-driven, humanized channelrhodopsin H134R mutant, fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam
Plasmid#16440PurposeContains two independent transcription units--a CMV promoter/enhancer upstream of a MCS and a HSV thymidine kinase promoter/enhancer upstream of the neomycin resistance gene.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only