We narrowed to 48,883 results for: des.1
-
Plasmid#221777PurposeExpresses GFP11x7-P2A-NES-FKBP-iLID-LRP6c(â–ł1-64) component in mammalian cellsDepositorInsertpCMV:: GFP11x7-P2A-NES-FKBP-iLID-LRP6c(â–ł1-64)
UseTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SPELL-pBabe-Vav2(DPZ) (Component 2-T2AP2A-Component 1)
Plasmid#170488PurposeSPELL Vav2(DH-PH-ZnF). Two components cloned into the same plasmid with T2A/P2A sequence. Component 2-T2A-P2A-Component 1DepositorInsertFRB, Vav2(C-lobe), iFKBP, Vav2(N-lobe), mCherry
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHD-T2A-split-intein-Gal4[1-20]-N-int
Plasmid#199203PurposeTo create "long homology arm" (~1000bp) knock-in donor vectors for split-intein Gal4[1-20]N-intDepositorInsertT2A-split-intein-Gal4[1-20]-N-int
UseTagsExpressionInsectMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDropIn-T2A-split-intein-Gal4[1-20]-N-int
Plasmid#199195PurposeInsert to create split-intein Gal4[N-int] knock-in vectors via Drop-In cloning, released via BsmBI digestDepositorInsertT2A-split-intein-Gal4[1-20]-N-int, 3xP3-dsRed
UseTagsExpressionInsectMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV5)
Viral Prep#154948-AAV5PurposeReady-to-use AAV5 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV9)
Viral Prep#154948-AAV9PurposeReady-to-use AAV9 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A10.T)
Viral Prep#157970-AAV.A10.TPurposeReady-to-use AAV6(dbY-F+T-V) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A08.T)
Viral Prep#157970-AAV.A08.TPurposeReady-to-use AAV2(4pMut)dHS in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV Retrograde)
Viral Prep#87306-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsNoneAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV9)
Viral Prep#154951-AAV9PurposeReady-to-use AAV9 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV5)
Viral Prep#154951-AAV5PurposeReady-to-use AAV5 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM233 - [Pmlc-1 | tagRFP-T | cbr-tbb-2 UTR]
Plasmid#159899PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | tagRFP | cbr-tbb-2 UTR
UseTagsExpressionWormMutationPromoterAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1354 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-1 CMV-BFP
Plasmid#226113PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
UseTagsFLAG, hsa-miR-1-5p Target Sites, and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic)
Plasmid#40325DepositorInsertMCP-1 promoter (mutated) (Ccl2 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationcontains MCP-1 promoter region through the nucleo…PromoterMCP-1Available sinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 XBB.1 T478R
Plasmid#212534PurposeEncodes SARS-CoV-2 variant XBB.1 Spike T478R for pseudovirus productionDepositorInsertSARS-CoV-2 Spike XBB.1 T478R (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable sinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDAX-396 FLAG UnaG[1] Stuffer/InteinA UnaG[2]
Plasmid#130144PurposePPI (BiFC/TriFC) assay vectorDepositorInsertUnaG
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDAX-460 N-Tag UnaG[1] L20 FKBP EBPF2
Plasmid#129927PurposePPI (BiFC/TriFC) assay vectorDepositorInsertFKBP
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only