We narrowed to 9,944 results for: CAG
-
Plasmid#36386DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shRFP
Plasmid#125778Purposeconstitutive expression of a short-hairpin RNA targeting RFPDepositorInsertshRFP
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMU-TLEr
Plasmid#61187PurposeFluorescent reporter for transitory late endosome mCherry-MtRAB7A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB7A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceMarch 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgBLM10
Plasmid#127643PurposeKnock-out of human BLMDepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
Plasmid#222994PurposeMammalian expression of iGeoCas9(C2) construct with EGFP-targeting sgRNADepositorInsertHuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
UseCRISPRTagsPuroExpressionMammalianPromoterpCAGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRb1/Cre
Plasmid#89647PurposeExpresses an Rb1-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherry
Plasmid#84249PurposeExpresses Sp sgSV40 gRNA with a mCherry fluorescent markerDepositorInsertSp sgSV40
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8
Plasmid#121958PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, short version
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ekker Lab TALEN kit
Plasmid Kit#1000000038PurposeComplete collection for assembly of highly active 15-RVD GoldyTALENs for expression in zebrafish. The collection complements the Golden Gate TALEN and TAL Effector Kit 2.0 (#1000000024).DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypeZebrafish ExpressionEditing TypeTALENCloning TypeGolden GateAvailable SinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCfB3050(gRNA XII-5)
Plasmid#73292PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 OCT4p eGFP SV40pA v2
Plasmid#115518PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows OCT4 dependent expression of GFP, and contains cHS4 insulators.DepositorInserteGFP
UseAAV; Donor plasmid for recombinase-mediated casseā¦ExpressionMammalianAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID5.3-C
Plasmid#145813PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAIDExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only