We narrowed to 21,829 results for: SPR
-
Plasmid#167501PurposeExpression of dual inducible Cas9 with EFS promoterDepositorInsertCas9
UseCRISPR, Lentiviral, and LuciferaseTagsFLAGExpressionMammalianPromoterEFSAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001147320)
Plasmid#77344Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pN7CAST
Plasmid#190661PurposeExpresses polycistronic N7 CAST where Cas12k-T2A-TnsC and TniQ-T2A-TnsB are separated by an EMCV IRESDepositorInserthuman codon optimized N7Cas12k, N7TnsC, N7TniQ, N7TnsB
ExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
hyA3A-BE4max
Plasmid#157943PurposeMammalian expression of hyA3A-BE4maxDepositorInserthyA3A-BE4max
UseCRISPRExpressionMammalianAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXGFPC-5 Pxyl-dcas9 (Sth3)
Plasmid#133317Purposeexpresses dcas9 (Streptococcus thermophilus #3); repressed with 0.2% glucose, induced with 0.3% xylose; for homologous recombination at the xyl locus in Caulobacter crescentus; tetracycline resistanceDepositorInsertdcas9 (Streptococcus thermophilus #3)
UseUnspecifiedPromoterxyloseAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1pr_v1-RT
Plasmid#97087PurposeEncodes a HR repair template for knock-in a YFP expression cassette at the promoter of human NEAT1 gene. Best used with px330-NEAT1pr_v1 vector, but also works with px330-NEAT1pr_v2.DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYS29
Plasmid#202086PurposeParent vector for producing universal minicircle donors for HaloTag N-terminal knock-inDepositorInsertNT HygR-T2A-Halo Minicircle Parent
UseCRISPRTagsHaloTagPromoterNoneAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-69: NPM1-mTagRFP-T
Plasmid#124608PurposeHomology arms and linker-mTagRFP-T sequence for C-terminus tagging of human NPM1DepositorInsertNPM1 Homology Arms with linker-mTagRFP-T (NPM1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceMay 13, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant
Plasmid#101217PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A, R1060A, N497A, R661A, Q695A and Q9…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335-NEAT1_IS_v2
Plasmid#97086PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.DepositorInsertsgRNA NEAT1_IS_v2
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335-NEAT1_IS_v1
Plasmid#97085PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.DepositorInsertsgRNA NEAT1_IS_v1
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1m_v1
Plasmid#97083PurposeEncodes an sgRNA that creates a DSB immediately downstream the poly(A) signal of human NEAT1_1 isoformDepositorInsertsgRNA NEAT1m_v1
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_9xD3B_Cluc_Norm
Plasmid#68414PurposeCRISPR-Display Cypridina Luciferase-2A-Venus YFP "normalizer," lentiviral format.DepositorInsertCypridina Luciferase-2A-Venus YFP
UseLentiviral and LuciferaseMutationYFP: M153T,V163A,S175G ("Venus") YFP Va…PromoterminimalCMVAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
R711-X04-566: His6-MBP-tev-Hs.NF1iso2 (1198-1530)
Plasmid#159579PurposeE. coli protein expression of His6-MBP-tev-Hs.NF1 DEF (1198-1530)DepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_02 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9NG-NLS-2A-Puro-WPRE
Plasmid#139087PurposeExpresses human codon-optimized Cas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationL1111R, D1135V,G1218R, E1219F, A1322R, R1335V, T1…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only