We narrowed to 16,198 results for: grna
-
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P1
Plasmid#80943PurposeExpresses Cas9N in mammalian cells; expresses gRNA P1 for Pd-l1 binding.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-gRNA-TnT-Cre
Plasmid#132551PurposeFor loss-of-function experiments in cardiomyocytesDepositorInsertsTnT-Cre
U6-gRNA
UseAAVPromoterTnT and U6Available SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(JARID2_5-4)-PGKpuroBFP-W
Plasmid#211966PurposeExpress gRNA against JARID2 with puro and BFPDepositorInsertsgRNA targeting JARID2 (JARID2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM002-sgRNA-lenti-ZeoR
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZDonor-Nm-Cas9-gRNA-hU6
Plasmid#61366Purposeempty backbone for cloning N. meningiditis protospacers. Encodes constant region of N. meningiditis Cas9 synthetic gRNADepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto_zhang2.0
Plasmid#167912PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP109 pEF1a-gRNA-GFP
Plasmid#100935PurposeGFP, puromycin and gRNA scaffold driven by EF1a promoterDepositorInsertgRNA scaffold
UseGrna scaffoldExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Puro_zhang2.0
Plasmid#167919PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
Plasmid#118842PurposeTargets cdkn2a and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInsertcdkn2a gRNA (LOC100329528 Zebrafish)
UseCRISPR; Tol2Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-PURO-LYSET-gRNA1
Plasmid#210489PurposeCRISPR pooled KO of human LYSETDepositorInsertLYSET-gRNA1 (LYSET Human)
UseCRISPR and LentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-PURO-LYSET-gRNA2
Plasmid#210490PurposeCRISPR pooled KO of human LYSETDepositorInsertLYSET-gRNA2 (LYSET Human)
UseCRISPR and LentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Hygro
Plasmid#167907PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P2
Plasmid#80944PurposeExpresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 bindingDepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC-CR7T-gRNA2.1-nlsBFP
Plasmid#170515PurposegRNA cloning vector containing a CR7T promoter, gRNA(2.1) scaffold, and a Ubi-mTagBFP-NLS marker; optimized for germline CRISPR.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterCR7TAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only