We narrowed to 16,648 results for: grn
-
Plasmid#100935PurposeGFP, puromycin and gRNA scaffold driven by EF1a promoterDepositorInsertgRNA scaffold
UseGrna scaffoldExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
Plasmid#118842PurposeTargets cdkn2a and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInsertcdkn2a gRNA (LOC100329528 Zebrafish)
UseCRISPR; Tol2Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-4)-PGKpuroBFP-W
Plasmid#211969PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-3)-PGKpuroBFP-W
Plasmid#211968PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMulti-sgRNA-LacZ-DsRed
Plasmid#99914PurposeReceptor plasmid for the assembly of multiple sgRNAs with DsRed coexpressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #1
Plasmid#179454PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #2
Plasmid#179455PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #3
Plasmid#179456PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA p53, mitfa:Cas9
Plasmid#118841PurposeTargets tp53 and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInserttp53 gRNA (tp53 Zebrafish)
UseCRISPR; Tol2Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(JARID2_5-4)-PGKpuroBFP-W
Plasmid#211966PurposeExpress gRNA against JARID2 with puro and BFPDepositorInsertsgRNA targeting JARID2 (JARID2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P2
Plasmid#80944PurposeExpresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 bindingDepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAC-CR7T-gRNA2.1-nlsBFP
Plasmid#170515PurposegRNA cloning vector containing a CR7T promoter, gRNA(2.1) scaffold, and a Ubi-mTagBFP-NLS marker; optimized for germline CRISPR.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterCR7TAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L2
Plasmid#113735PurposeGateway entry vector containing attL1 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto_zhang2.0
Plasmid#167912PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only