We narrowed to 6,780 results for: ins/1000
-
Plasmid#17596DepositorInsertIFN gamma promoter (IFNG Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation-204 to +38 of promoterAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DDX43
Plasmid#134574PurposeExpress human DDX43 protein (WT, full-length) in E. coliDepositorAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pcDNA3
Plasmid#206069Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xA
Plasmid#92007PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-p53
Plasmid#133900PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xE
Plasmid#92008PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2
Plasmid#73538PurposeInducible lentiviral expression of Ago2DepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-DuET
Plasmid#213233PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CX3C1-DuET
Plasmid#213217PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-Flag-Ago2
Plasmid#72207PurposeMammalian expression of full-length human Ago2DepositorInsertargonaute RISC catalytic component 2 (AGO2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo
Plasmid#212821PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo in mammalian cellsDepositorAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
TagsECFP and FLAGExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-FLAG-Tev_ACTA1 (alpha-actin)
Plasmid#188452PurposeExpress in mammalian cells human alpha-actin (ACTA1) with N-terminal 6xHis tag, FLAG tag, and TEV protease site.DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hAID-BE3
Plasmid#113417PurposeExpresses hAID-BE3 in mammalian cellsDepositorInserthAID-BE3 (AICDA Human, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF3
Plasmid#65383PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTetON-BMP2/7
Plasmid#137913PurposeInducible mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, divergent)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVAX1-BMP2/7 +
Plasmid#137911PurposeConstitutive mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, tandem)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only