We narrowed to 7,855 results for: Trac
-
Plasmid#159487PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(1)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pMA2640
Plasmid#25434PurposeRetroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selectionDepositorInsertreverse tetracycline-regulated transactivator Advanced
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-eGFP
Plasmid#157733Purposemammalian expression of untagged eGFP under control of a tetracycline-inducible promoterDepositorInserteGFP
ExpressionMammalianAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZH509
Plasmid#102664PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
C1-MPAct-mCherry
Plasmid#155222PurposeMonitor changes in the density of membrane-proximal F-actin (MPA)DepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCherry C-term tagged with the CaaX sequence derived from Kras4b
TagsmCherryExpressionMammalianAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GCaMP6s
Plasmid#166606PurposeEncodes Cre-dependent GCaMP6s under control of the TREDepositorInsertGCaMP6s
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAF257
Plasmid#105497PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible SmBiT and HupA-LgBiTDepositorInsertSmBiT/HupA-LgBiT
UseAtc-dependent expression in c. difficilePromoterPtetAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-tdTomatof
Plasmid#104060PurposeAlso known as hSyn1-tdTomato-f. AAV expression of Farnylsated tdtomato for tracingDepositorInserttdTomato
UseAAVPromoterhSynAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOxyR_rfp
Plasmid#194155PurposeRed Fluorescent Reporter of intracellular hydrogen peroxideDepositorInserttranscriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
ExpressionBacterialPromoterPoxyR, PoxySAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
C1-MPAct-mCitrine
Plasmid#155220PurposeMonitor changes in the density of membrane-proximal F-actin (MPA)DepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCitrine C-term tagged with the CaaX sequence derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-lvaA
Plasmid#106397PurposeGuide RNA plasmid targeting lvaA on BBR1-UP originDepositorInsertsgRNA towards lvaA in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CpxR-GFP
Plasmid#220150PurposeTo track the natural CpxR promoter's transcriptional dynamicsDepositorInsertCpxR promoter only
ExpressionBacterialAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAX DAB1
Plasmid#30139DepositorAvailable SinceJune 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
EF.hICN1.Ubc.GFP
Plasmid#17626DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDAI-SceI-pheS
Plasmid#111611PurposeYeast homing endonuclease I - SceI expression vector. Used for resolution of merodiploids during allelic exchange in Burkholderia sp.DepositorInsertpheS
ExpressionBacterialAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA
Plasmid#108236PurposeBroad host bacterial expression vector with constitutive PsbA promoterDepositorInsertPsbA promoter
ExpressionBacterialAvailable SinceMay 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
T7-TetO-GFP_ColE1
Plasmid#173193PurposeExpresses GFP under the control of a T7-TetO promoter. Expression can be repressed via TetR, and repression can be relieved via addition of tetracycline. Contains the ColE1 origin of replication.DepositorInsertT7-TetO
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only