We narrowed to 58,551 results for: IND;
-
Plasmid#129627PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsertLck-cpmTq2-Calcium-lifetime-sensor
TagsLckExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TET-mKLF4
Plasmid#20906PurposepiggyBac vector with tet inducible mKLF4DepositorAvailable SinceApril 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMiR-RECK-3'UTR
Plasmid#53614PurposeLuciferase reporter assay for microRNA binding on the RECK 3'UTRDepositorInsertRECK-3'UTR (RECK Human)
UseLuciferaseAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-U1AF37MF77M
Plasmid#168267PurposeExpresses human dmU1A with the F37M/F77M double mutantDepositorInsertU1A RRM1 crystallization module (SNRPA Human)
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F37M and F77MPromoterT7 promotorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTriEX-Antenna-GDI Rac1
Plasmid#83359PurposeExpression of Antenna-Rac1DepositorInsertRac1 (RAC1 Human)
TagsFRET Antenna (mCerulean-cpVenus) and HisExpressionBacterial, Insect, and Mamm…PromoterCMVAvailable SinceMarch 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 KanR foundation lox casette
Plasmid#132388PurposeFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locusDepositorInsertG418 resistance
UseCRISPR and Cre/LoxExpressionMammalianPromoterpromoterlessAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xnls-cpmTq2-Calcium-lifetime-sensor
Plasmid#129626PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-cpmTq2-Calcium-lifetime-sensor
Tags3xNLSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS-45
Plasmid#40586DepositorTagsHis-tag and yTAND12ExpressionBacterialPromoterT7Available SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN-Tax
Plasmid#44038DepositorAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR-W741C
Plasmid#171247PurposeMammalian expression of 3xFlag-tagged human androgen receptor mutant that binds to bicalutamide: AR-Trp741Cys (AR-W741C)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys (AR-W741C)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
MLM3720
Plasmid#49944PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Id2
Plasmid#70764PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Id2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTS_mScarlet-H_N1
Plasmid#85058PurposeIn vivo visualization of the mitochondria (can be used for colocalization studies)DepositorAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-Nterm-N1
Plasmid#131800PurposeExpresses the [N-terminus of human CTCF (a.a. 2-265)]-GFP in mammalian cellsDepositorInsertCTCF (CTCF Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 796-2181 (the N-terminus is l…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-dCas9-BirA*
Plasmid#159994PurposeBacterial expression of dCas9-BirA*DepositorInsertdCas9-BirA*
Tags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only